Review



algorithms cfx maestro software bio rad n a graphpad prism 8 graphpad n a las x leica n a  (Bio-Rad)


Bioz Verified Symbol Bio-Rad is a verified supplier
Bioz Manufacturer Symbol Bio-Rad manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 98
      Buy from Supplier

    Structured Review

    Bio-Rad algorithms cfx maestro software bio rad n a graphpad prism 8 graphpad n a las x leica n a
    Algorithms Cfx Maestro Software Bio Rad N A Graphpad Prism 8 Graphpad N A Las X Leica N A, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 4013 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+8+graphpad+software/CFX+Maestro+Software/pm38159278-188-256-260
    Average 98 stars, based on 4013 article reviews
    algorithms cfx maestro software bio rad n a graphpad prism 8 graphpad n a las x leica n a - by Bioz Stars, 2026-10
    98/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: 18S rRNA methyltransferases DIMT1 and BUD23 drive intergenerational hormesis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli New England Biolabs BL21 Escherichia coli New England Biolabs NEB C2925 Chemicals, peptides, and recombinant proteins SAM-3H3 PerkinElmer NET155H001MC Methionine-3H3 PerkinElmer NET061X001MC SAM-D3 Sigma A7007 Methionine-D3 Cayman 34826 SuperScript III Reverse Transcriptase Thermo 18080044 RNAse H New England Biolabs M0297 RNAse A/T1 Thermo EN0551 RNase S7 Roche 50-100-3364 Novex 2X TBE-Urea Sample Buffer Thermo LC6876 RNasin Promega N2615 Nuclease P1 Wako 145-08221 DNA Degradase Plus Zymo E2021 Nucleoside Digestion Mix New England Biolabs M069S rSAP New England Biolabs M0371 T4 PNK New England Biolabs M0201 [g-32P]ATP Perkin Elmer NEG002A001MC T4 DNA ligase New England Biolabs M0437 TURBO DNase Ambion AM2239 SuperScript III First-Strand Synthesis System Thermo 18080051 iTaq Universal SYBR Green Supermix Bio-Rad 1725121 Critical commercial assays Bradford assay Bio-Rad 5000002 Pierce BCA Protein Assay Kit ThermoFisher 23225 PureLink RNA Mini Kit Invitrogen 12183018A Direct-zol RNA Kit Zymo R2051 Zymoclean Gel RNA Recovery Kit Zymo D4007 Oligo d(T25) Magnetic Beads New England Biolabs S1419S RiboMinus Eukaryote Sytem v2 Invitrogen A15020 TRIzol Invitrogen 15596026 TRI reagent Invitrogen AM9738 Bio-Spin 5 column Bio-Rad 7326002 Fuji Imaging Plate Fujifilm ST-6/HR-6/ST-BD/HR-BD PEI-cellulose Plate Merck Millpore 105579 BAS storage phosphor screen GE Healthcare Life Sciences 29175523 Amicon filter columns Millipore UFC5003BK Novex 15% TBE-Urea gel Life Technologies EC6885BOX Novex 6% TBE-Urea gel Life Technologies EC6865BOX TruSeq Small RNA kit Illumina RS-200-0012 1-kb DNA ladder Invitrogen 10-787-018 (Continued on next page) Molecular Cell 83, 3268–3282.e1–e7, September 21, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Raw and analyzed data This paper GEO: GSE175363 Unprocessed Images This paper https://doi.org/10.17632/wd4tg4mjfp.2 Experimental models: Organisms/strains C. elegans: Strain N2 Bristol Caenorhabditis Genetics Center N2 C. elegans: Strain bud-23 Shouhoung Guang Lab tm5768 Oligonucleotides A1735, 1736: GCUGUAGGUGAACCUGCAGCU This paper N/A A1735,1736->G: GCUGUAGGUGGGCCUGCAGCUGG This paper N/A 18S F 50-CGATAACAGGTCTGTGATGCCC-30 Liao et al.68 N/A 18S R 50-TACCCTATCCCGGACATGGAAG-30 Liao et al.68 N/A 26S F 50-TAATGTCCTCAACCTATTCTCAA-30 Liao et al.68 N/A 26S R 50-GCCAGTTCTGCTTACCAA-30 Liao et al.68 N/A rpl-26 F 50-CCGATGATGAGGTCGTCGTT-30 This paper N/A rpl-26 R 50-GCACAGTGGATCCGTTAGCC-30 This paper N/A pan-actin F 50-TCGGTATGGGACAGAAGGAC-30 N/A pan-actin R 50-CATCCCAGTTGGTGACGATA-30 N/A Remaining oligonucleotides in Table S4 Table S4 Table S4 Recombinant DNA pSD1::bud-23 This paper N/A pSD1::bud-23 G63E/D82K This paper N/A pTG96 Will Mair lab N/A Software and algorithms Prism 8.4.3 Graphpad N/A Chemidoc Image Lab (v4.0) Bio-Rad N/A ImageQuantTL GE Healthcare Life Sciences N/A MassHunter Suite Agilent N/A ImageJ Schneider et al.69 https://imagej.nih.gov/ij/ Cutadapt Martin70 https://github.com/marcelm/cutadapt STAR Dobin et al.71 https://github.com/alexdobin/STAR DESeq2 Love et al.72 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html GSEA Subramaniam et al.73 https://www.gsea-msigdb.org/gsea/ index.jsp Other Bioinformatics pipeline and supplementary code This paper https://doi.org/10.5281/zenodo.8231900 and https://github.com/germaximus/ Greer_2021 ..

    Article Title: TERRA stability is regulated by RALY and polyadenylation in a telomere-specific manner.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-RALY Bethyl Cat#A302-069A; RRID: AB_1604210 Rabbit polyclonal anti-PABPN1 Bethyl Cat# A303-524A; RRID: AB_10949200 Rabbit polyclonal anti-EXOSC3 Proteintech Cat#15062-1-AP; RRID: AB_2278183 Mouse monoclonal anti-b-Tubulin Santa Cruz Cat# sc-5274; RRID: AB_2288090 Mouse monoclonal anti-a-Actinin Santa Cruz Cat#sc-17829; RRID: AB_626633 Rabbit polyclonal anti-mouse IgG H&L (HRP) Abcam Cat#ab6728; RRID: AB_955440 Goat polyclonal anti-rabbit IgG H&L (HRP) Abcam Cat#ab6721; RRID: AB_955447 Normal rabbit polyclonal IgG Millipore Cat# PP64; RRID: AB_97852 Sheep anti-Digoxigenin-AP, Fab fragments Roche Cat#11093274910; RRID: AB_514497 Rabbit polyclonal anti-RAP1 Novus Biologicals Cat#NB100-292; RRID: AB_10000825 Mouse monoclonal anti-phospho-Histone H2A.X Millipore Cat#05–636; RRID: AB_309864 Goat polyclonal anti-rabbit IgG-AF647 Thermo Fisher Scientific Cat#A-21245; RRID: AB_2535813 Goat polyclonal anti-rabbit IgG-AF555 Thermo Fisher Scientific Cat#A-21428; RRID: AB_2535849 Goat polyclonal anti-mouse IgG-AF488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Mouse monoclonal anti-BrdU Santa Cruz Cat#sc-32323; RRID: AB_626766 Rabbit monoclonal anti-V5 Cell Signaling Cat# 13202; RRID: AB_2687461 Chemicals, peptides, and recombinant proteins Oligofectamine Transfection Reagent Invitrogen 12252011 jetPRIME Transfection Reagent Polyplus 114–15 Actinomycin D Gibco 11805017 Pierce Protease Inhibitor Mini Tablets Thermo Scientific A32955 RiboLock RNase Inhibitor Thermo Scientific EO0381 RNaseOUT Recombinant Ribonuclease Inhibitor Invitrogen 10777019 Ribonucleoside Vanadyl Complex NEB S1402S Dynabeads Protein G Invitrogen 10003D Dynabeads M-280 Streptavidin Invitrogen 11205D SuperSignal West Pico PLUS ECL Substrate Thermo Scientific 34577 CDP-Star ECLSubstrate Roche 11685627001 TRIzol Reagent Invitrogen 15596018 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Fisher BioReagents BP1752I400 Formaldehyde Fisher BioReagents BP531-500 MOPS Fisher BioReagents BP308-100 Formamide AppliChem A2156,0500 Blocking Reagent Roche 11096176001 KAPA SYBR FAST qPCR Mastermix KAPA Biosystems KK4601 qPCRBIO SyGreen Mix Separate-ROX PCR Biosystems PB20.14–20 DNase I Thermo Scientific 89836 RNase A Macherey Nagel 740505 RNase T1 Thermo Scientific EN0541 Proteinase K Thermo Scientific EO0491 Glycogen Invitrogen 10814010 SuperScript III Reverse Transcriptase Invitrogen 18080044 dNTP Set Invitrogen 10297018 NEBuffer 3 NEB B7003S (Continued on next page) 16 Cell Reports 42, 112406, April 25, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER ProLong Diamond Antifade Mountant Invitrogen P36965 BrUTP Santa Cruz sc-495784 Critical commercial assays DIG Oligonucleotide 3-End Labeling Kit Roche 3353575910 Poly(A) RNA Selection Kit Lexogen 157.96 Experimental models: Cell lines Human: HeLa ATCC CCL-2TM Human: HeLa RALY KO Macchi Lab Rossi et al. 201739 Human: U2OS ATCC HTB-96TM Human: MCF7 ATCC HTB-22TM Human: HCT116 ATCC CCL-247TM Oligonucleotides siRNA, see Table S2 N/A N/A RT primers, see Table S2 N/A N/A qPCR primers, see Table S2 N/A N/A Blot probes, see Table S2 N/A N/A smiFISH probes, see Table S2 N/A N/A RNA pull-down oligonucleotides, see Table S2 N/A N/A Recombinant DNA pCMV6-entry Macchi Lab Origene #PS100001 pCMV6-entry-RALY Macchi Lab Gasperini et al. 201842 ppyCAG_RNaseH1_WT Zippo Lab Addgene #111906 ppyCAG_RNaseH1_D210N Zippo Lab Addgene #111904 ppyCAG_RNaseH1_WKKD Zippo Lab Addgene #111905 Software and algorithms Image Lab 6.0.1 Bio-Rad https://www.bio-rad.com/it-it/product/ image-lab-software?ID=KRE6P5E8Z ImageJ NIH https://imagej.net/ Prism 8.0.0 GraphPad www.graphpad.com BioRender BioRender BioRender.com ..

    Article Title: Rapid and sensitive one-tube detection of mpox virus using RPA-coupled CRISPR-Cas12 assay.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains VACV Tiantan strain this paper JX489139.1 MPVX Wenjie Tan MPVX-B.1-China-C-Tan-CQ01 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin (5,000 U/mL) Thermo Fisher Scientific Cat#15070063 DMEM Hyclone Cat#SH30243.01 FBS Hyclone Cat#SH30396.02 EcoRI-HF NEB Cat#R3101S BamHI-HF NEB Cat#R3136S GenCRISPRTM Cas12a (Cpf1) Nuclease GenScript Cat#Z03502 10xNEBuffer2.1 NEB Cat# B6002S Critical commercial assays QIAamp DNA Mini Kit Qiagen Cat#51306 TwistAmp Basic kit TwistDx Cat#TABAS03KIT QuantStudio 3DDigital PCR 20KChip Kit v2 Applied Biosystems Cat#A26316 Experimental models: Cell lines Vero ATCC Cat# CRL-1586 Oligonucleotides ddPCR E9L-F this paper 50-GAACATTTTTGGCAGAGAGAGCC-30 ddPCR E9L-R this paper 50-CAACTCTTAGCCGAAGCGTATGAG-30 ddPCR Probe this paper FAM- ACGCTTCGGCTAAGAGTTGCACATCCATAMRA crRNAs and RPA primers used in the study this paper Table S1 Recombinant DNA puc57-D6R this paper N/A puc57-E9L this paper N/A puc57-N3R this paper N/A puc57-N4R this paper N/A Software and algorithms BIO-RAD CFX manager Bio-RAD 1845000 GraphPad Prism 8.0 software GraphPad Prism N/A ..

    Article Title: Cell-surface biotinylation of GABA A receptors in mouse hippocampal slices after sevoflurane anesthesia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GABRA5 monoclonal antibody Thermo Fisher Scientific MA5-27700 Na/K-ATPase Antibody Cell Signaling Technology 3010 THE beta Actin Antibody [HRP] GenScript A00702 Chemicals, peptides, and recombinant proteins Oxygen (O2) Messer 100354 Medical air Messer 100034 Carbogen gas Messer 100904 Sodium chloride (NaCl) BioShop SOD002 N-2-Hydroxyethylpiperazine-N02-ethanesulfonic acid (HEPES) BioShop HEP001 Ethylenediaminetetraacetic acid (EDTA) BioShop EDT001 Triton X-100 Sigma-Aldrich X-100 10% Sodium dodecyl sulfate (SDS) Promega V6551 cOmplete , Mini, EDTA-free Protease Inhibitor Cocktail Sigma-Aldrich 11836170001 Pierce Phosphatase Inhibitor Mini Tablets Thermo Fisher Scientific A32957 Sodium chloride (NaCl) BioShop SOD002 Potassium chloride (KCl) BioShop POC308 Magnesium chloride (MgCl2) BioShop MAG510 Calcium chloride (CaCl2) BioShop CCL302 Monosodium phosphate (NaH2PO4) Sigma-Aldrich S9638 Sodium bicarbonate (NaHCO3) Sigma-Aldrich S6014 D-glucose BioShop GLU501 EZ-LinkTM Sulfo-NHS-SS-biotin Thermo Fisher Scientific 21331 Bovine serum albumin Sigma-Aldrich A7030 Glycine Bio Basic Canada Inc. GB0235 23 Laemmli sample buffer Bio-Rad 1610737 NeutraAvidin beads Thermo Fisher Scientific 29202 Hydrochloric acid (HCl) BioShop HCL333.500 Experimental models: Organisms/strains Mouse C57BL/6, 8–9 weeks, male Charles River N/A Software and algorithms Image Lab 6.0 Bio Rad www.bio-rad.com/en-ca/sku/ 1709690-image-lab-software Prism 9 GraphPad www.graphpad.com/features Other 1.5 mL Eppendorf tubes Axygen MCT-150-C F/Air Canister Benson Medical 20522 F/Air Canister Bracket Benson Medical 20526 Scavenging tubing 19 mm magenta Benson Medical 10024 ‘‘Y’’ Piece Adapter (7 mm Ends) Benson Medical 30614-55 Silicone tubing Benson Medical 20810 Gas analyzer Datex Engstrom ULT-Svi-29-08 Heating pad Sunbeam 731-500-000R Induction chamber Benson Medical 941443 Microcentrifuge Beckman Coulter 8043-30-1145 Rotating Mixer Benchmark Scientific 1190B06 Probe sonicator Active Motif www.activemotif.com/catalog/ 719/epishear-probe-sonicatorwww. activemotif.com (Continued on next page) 4 STAR Protocols 4, 102450, September 15, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER AE150 Benchtop pH meter Fisher Scientific www.fishersci.com/shop/products/ accumet-ae150-ph-benchtopmeter/13636AE153 Sigma Delta Vaporizer Penlon www.penlon.com/Product-Groups/ Vaporizer/Sigma-Deltawww.penlon.com Leica VT1200 Microtome Leica www.leicabiosystems.com/en-ca/ research/vibratomes/leica-vt1200/ www.leicabiosystems.com ChemiDoc XRS+ Bio-Rad www.bio-rad.com/en-ca/product/ chemidoc-xrs-system ll OPEN ACCESSProtocol ..

    Software:

    Article Title: 18S rRNA methyltransferases DIMT1 and BUD23 drive intergenerational hormesis.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains Escherichia coli New England Biolabs BL21 Escherichia coli New England Biolabs NEB C2925 Chemicals, peptides, and recombinant proteins SAM-3H3 PerkinElmer NET155H001MC Methionine-3H3 PerkinElmer NET061X001MC SAM-D3 Sigma A7007 Methionine-D3 Cayman 34826 SuperScript III Reverse Transcriptase Thermo 18080044 RNAse H New England Biolabs M0297 RNAse A/T1 Thermo EN0551 RNase S7 Roche 50-100-3364 Novex 2X TBE-Urea Sample Buffer Thermo LC6876 RNasin Promega N2615 Nuclease P1 Wako 145-08221 DNA Degradase Plus Zymo E2021 Nucleoside Digestion Mix New England Biolabs M069S rSAP New England Biolabs M0371 T4 PNK New England Biolabs M0201 [g-32P]ATP Perkin Elmer NEG002A001MC T4 DNA ligase New England Biolabs M0437 TURBO DNase Ambion AM2239 SuperScript III First-Strand Synthesis System Thermo 18080051 iTaq Universal SYBR Green Supermix Bio-Rad 1725121 Critical commercial assays Bradford assay Bio-Rad 5000002 Pierce BCA Protein Assay Kit ThermoFisher 23225 PureLink RNA Mini Kit Invitrogen 12183018A Direct-zol RNA Kit Zymo R2051 Zymoclean Gel RNA Recovery Kit Zymo D4007 Oligo d(T25) Magnetic Beads New England Biolabs S1419S RiboMinus Eukaryote Sytem v2 Invitrogen A15020 TRIzol Invitrogen 15596026 TRI reagent Invitrogen AM9738 Bio-Spin 5 column Bio-Rad 7326002 Fuji Imaging Plate Fujifilm ST-6/HR-6/ST-BD/HR-BD PEI-cellulose Plate Merck Millpore 105579 BAS storage phosphor screen GE Healthcare Life Sciences 29175523 Amicon filter columns Millipore UFC5003BK Novex 15% TBE-Urea gel Life Technologies EC6885BOX Novex 6% TBE-Urea gel Life Technologies EC6865BOX TruSeq Small RNA kit Illumina RS-200-0012 1-kb DNA ladder Invitrogen 10-787-018 (Continued on next page) Molecular Cell 83, 3268–3282.e1–e7, September 21, 2023 e1 .. REAGENT or RESOURCE SOURCE IDENTIFIER Deposited data Raw and analyzed data This paper GEO: GSE175363 Unprocessed Images This paper https://doi.org/10.17632/wd4tg4mjfp.2 Experimental models: Organisms/strains C. elegans: Strain N2 Bristol Caenorhabditis Genetics Center N2 C. elegans: Strain bud-23 Shouhoung Guang Lab tm5768 Oligonucleotides A1735, 1736: GCUGUAGGUGAACCUGCAGCU This paper N/A A1735,1736->G: GCUGUAGGUGGGCCUGCAGCUGG This paper N/A 18S F 50-CGATAACAGGTCTGTGATGCCC-30 Liao et al.68 N/A 18S R 50-TACCCTATCCCGGACATGGAAG-30 Liao et al.68 N/A 26S F 50-TAATGTCCTCAACCTATTCTCAA-30 Liao et al.68 N/A 26S R 50-GCCAGTTCTGCTTACCAA-30 Liao et al.68 N/A rpl-26 F 50-CCGATGATGAGGTCGTCGTT-30 This paper N/A rpl-26 R 50-GCACAGTGGATCCGTTAGCC-30 This paper N/A pan-actin F 50-TCGGTATGGGACAGAAGGAC-30 N/A pan-actin R 50-CATCCCAGTTGGTGACGATA-30 N/A Remaining oligonucleotides in Table S4 Table S4 Table S4 Recombinant DNA pSD1::bud-23 This paper N/A pSD1::bud-23 G63E/D82K This paper N/A pTG96 Will Mair lab N/A Software and algorithms Prism 8.4.3 Graphpad N/A Chemidoc Image Lab (v4.0) Bio-Rad N/A ImageQuantTL GE Healthcare Life Sciences N/A MassHunter Suite Agilent N/A ImageJ Schneider et al.69 https://imagej.nih.gov/ij/ Cutadapt Martin70 https://github.com/marcelm/cutadapt STAR Dobin et al.71 https://github.com/alexdobin/STAR DESeq2 Love et al.72 https://bioconductor.org/packages/ release/bioc/html/DESeq2.html GSEA Subramaniam et al.73 https://www.gsea-msigdb.org/gsea/ index.jsp Other Bioinformatics pipeline and supplementary code This paper https://doi.org/10.5281/zenodo.8231900 and https://github.com/germaximus/ Greer_2021 ..

    Article Title: TERRA stability is regulated by RALY and polyadenylation in a telomere-specific manner.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-RALY Bethyl Cat#A302-069A; RRID: AB_1604210 Rabbit polyclonal anti-PABPN1 Bethyl Cat# A303-524A; RRID: AB_10949200 Rabbit polyclonal anti-EXOSC3 Proteintech Cat#15062-1-AP; RRID: AB_2278183 Mouse monoclonal anti-b-Tubulin Santa Cruz Cat# sc-5274; RRID: AB_2288090 Mouse monoclonal anti-a-Actinin Santa Cruz Cat#sc-17829; RRID: AB_626633 Rabbit polyclonal anti-mouse IgG H&L (HRP) Abcam Cat#ab6728; RRID: AB_955440 Goat polyclonal anti-rabbit IgG H&L (HRP) Abcam Cat#ab6721; RRID: AB_955447 Normal rabbit polyclonal IgG Millipore Cat# PP64; RRID: AB_97852 Sheep anti-Digoxigenin-AP, Fab fragments Roche Cat#11093274910; RRID: AB_514497 Rabbit polyclonal anti-RAP1 Novus Biologicals Cat#NB100-292; RRID: AB_10000825 Mouse monoclonal anti-phospho-Histone H2A.X Millipore Cat#05–636; RRID: AB_309864 Goat polyclonal anti-rabbit IgG-AF647 Thermo Fisher Scientific Cat#A-21245; RRID: AB_2535813 Goat polyclonal anti-rabbit IgG-AF555 Thermo Fisher Scientific Cat#A-21428; RRID: AB_2535849 Goat polyclonal anti-mouse IgG-AF488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Mouse monoclonal anti-BrdU Santa Cruz Cat#sc-32323; RRID: AB_626766 Rabbit monoclonal anti-V5 Cell Signaling Cat# 13202; RRID: AB_2687461 Chemicals, peptides, and recombinant proteins Oligofectamine Transfection Reagent Invitrogen 12252011 jetPRIME Transfection Reagent Polyplus 114–15 Actinomycin D Gibco 11805017 Pierce Protease Inhibitor Mini Tablets Thermo Scientific A32955 RiboLock RNase Inhibitor Thermo Scientific EO0381 RNaseOUT Recombinant Ribonuclease Inhibitor Invitrogen 10777019 Ribonucleoside Vanadyl Complex NEB S1402S Dynabeads Protein G Invitrogen 10003D Dynabeads M-280 Streptavidin Invitrogen 11205D SuperSignal West Pico PLUS ECL Substrate Thermo Scientific 34577 CDP-Star ECLSubstrate Roche 11685627001 TRIzol Reagent Invitrogen 15596018 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Fisher BioReagents BP1752I400 Formaldehyde Fisher BioReagents BP531-500 MOPS Fisher BioReagents BP308-100 Formamide AppliChem A2156,0500 Blocking Reagent Roche 11096176001 KAPA SYBR FAST qPCR Mastermix KAPA Biosystems KK4601 qPCRBIO SyGreen Mix Separate-ROX PCR Biosystems PB20.14–20 DNase I Thermo Scientific 89836 RNase A Macherey Nagel 740505 RNase T1 Thermo Scientific EN0541 Proteinase K Thermo Scientific EO0491 Glycogen Invitrogen 10814010 SuperScript III Reverse Transcriptase Invitrogen 18080044 dNTP Set Invitrogen 10297018 NEBuffer 3 NEB B7003S (Continued on next page) 16 Cell Reports 42, 112406, April 25, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER ProLong Diamond Antifade Mountant Invitrogen P36965 BrUTP Santa Cruz sc-495784 Critical commercial assays DIG Oligonucleotide 3-End Labeling Kit Roche 3353575910 Poly(A) RNA Selection Kit Lexogen 157.96 Experimental models: Cell lines Human: HeLa ATCC CCL-2TM Human: HeLa RALY KO Macchi Lab Rossi et al. 201739 Human: U2OS ATCC HTB-96TM Human: MCF7 ATCC HTB-22TM Human: HCT116 ATCC CCL-247TM Oligonucleotides siRNA, see Table S2 N/A N/A RT primers, see Table S2 N/A N/A qPCR primers, see Table S2 N/A N/A Blot probes, see Table S2 N/A N/A smiFISH probes, see Table S2 N/A N/A RNA pull-down oligonucleotides, see Table S2 N/A N/A Recombinant DNA pCMV6-entry Macchi Lab Origene #PS100001 pCMV6-entry-RALY Macchi Lab Gasperini et al. 201842 ppyCAG_RNaseH1_WT Zippo Lab Addgene #111906 ppyCAG_RNaseH1_D210N Zippo Lab Addgene #111904 ppyCAG_RNaseH1_WKKD Zippo Lab Addgene #111905 Software and algorithms Image Lab 6.0.1 Bio-Rad https://www.bio-rad.com/it-it/product/ image-lab-software?ID=KRE6P5E8Z ImageJ NIH https://imagej.net/ Prism 8.0.0 GraphPad www.graphpad.com BioRender BioRender BioRender.com ..

    Article Title: Tubuloid differentiation to model the human distal nephron and collecting duct in health and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NKCC2 MRC PPU N/A Anti-AQP3 Abcam ab125219 Anti-AQP2 Sigma Aldrich HPA046834 Anti-NCC Sigma Aldrich ab3553 Anti-ROMK Sigma Aldrich HPA026962 Anti-ENaC Sigma Aldrich HPA012743 Anti-Na/K-ATPase Abcam ab7671 Anti-Vimentin Dako M7020 Anti-Ki67 Abcam ab16667 Anti-acetylated-a-tubulin Santa Cruz sc-23950 AF-568 donkey anti-sheep Invitrogen A21099 AF568 donkey anti-rabbit Life technologies A10042 AF-488 donkey anti-rabbit Life technologies A21206 AF-647 donkey anti-mouse Invitrogen A31571 AF-488 donkey anti-mouse Life technologies A21202 Phalloidin–Atto 647N Sigma Aldrich 65906 Rabbit-anti-sheep DAKO P0163 Envision + System-HRP polymer anti-mouse DAKO K4001 Envision + System-HRP polymer anti-rabbit DAKO K4002 Biological samples Human kidney tissue for organoids and stainings Meander Medical Center Amersfoort N/A Chemicals, peptides, and recombinant proteins Advanced DMEM-F12 Thermo Fisher Scientific 12634–010 Penicillin/Streptomycin Thermo Fisher Scientific 15140122 HEPES Thermo Fisher Scientific 15630056 GlutaMax Thermo Fisher Scientific 35050038 R-spondin 3-conditioned medium U-Protein Express Custom order B-27 supplement Thermo Fisher Scientific 17504044 Human EGF Peprotech AF-100-15 FGF10 Peprotech 100–26 A83-01 Tocris 2939 N-Acetyl-L-Cysteine Sigma Aldrich A9165 Y-27632 dihydrochloride AbMole M1817 Primocin Invivogen ant-pm-1 Forskolin Tocris 1099 Fludrocortisone acetate Sigma Aldrich F0180000 Furosemide Sigma Aldrich F4381 Sodium acetate Riedel-de Haën 32319 Lithium acetate dihydrate Sigma Aldrich L6883 CHIR-99021 Tocris 4423 Afatinib Selleckchem S1011 SCH772984 Selleckchem S7101 (Continued on next page) 20 Cell Reports 43, 113614, January 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD0325901 Selleckchem S1036 Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 R&D Systems, Bio-Techne 3533-001-02 Dispase II Thermo Fisher Scientific 17105041 Accutase Thermo Fisher Scientific 00-4555-56 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190094 Methanol Boom 76025369.2500 Random primers Promega C1181 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Promega M3682 iQ SYBR Green Supermix Bio-Rad 1708880 Cell Recovery Solution Corning 354253 Formaldehyde 4% Sigma Aldrich 1.00496 Triton X-100 Sigma Aldrich X100 Tween 20 Sigma Aldrich P1379 Bovine Serum Albumine Sigma Aldrich A2153 DAPI Thermo Fisher Scientific D1306 VECTASHIELD antifade mounting medium Vector Laboratories H-1000-10 CellTiter-Glo 3D Cell Viability Assay Promega G9681 96-wells flat bottom chimney plate black Greiner Bio-One 655076 Sensoplate microplate 96-well glass bottom Greiner Bio-One 655892 Greiner CELLSTAR 24-well culture plates Greiner Bio-One 662160 Greiner CELLSTAR 6-well cell-repellent culture plates Greiner Bio-One 657970 Sodium chloride (NaCl) BOOM B.V. 76021267.5000 Potassium chloride (KCl) Sigma Aldrich 1049361000 Calcium chloride dihydrate (CaCl2) Sigma Aldrich 76021267.5000 Magnesium chloride hexahydrate (MgCl2) VWR 1.05833.0250 D-Gluconic acid sodium salt (Na+ D-gluconate) Sigma Aldrich G9005-500G Potassium D-gluconate (K+ D-gluconate) Sigma Aldrich 8206010500 Tris ultra pure MP Biomedicals 819619 Hydrochlorothiazide Sigma Aldrich H4759-5G Bumetanide Sigma Aldrich B3023-1G Amiloride Sigma Aldrich A7410-1g Ouabain MP Biomedicals 102541 DMSO Sigma Aldrich D5879-1L Tracer22Na+ radionuclide Perkin Elmer NEZ081500UC Crystal Violet Santa Cruz sc-207460 Critical commercial assays RNeasy mini kit Qiagen 74104 InvitrogenTM FluxORTM II Green Potassium Ion Channel Assay Fisher Scientific 15647958 Deposited data Raw and analyzed single cell-RNA sequencing data Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/ GSE206538 Software and algorithms CFX maestro software Bio-Rad N/A GraphPad Prism 8 GraphPad N/A Las X Leica N/A (Continued on next page) Cell Reports 43, 113614, January 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fiji NIH, Fiji developers https://ImageJ.net/Fiji Adobe Illustrator Adobe inc. N/A RStudio RStudio (https://rstudio.com/) N/A Seurat (version 4.1.0) Hao et al.

    Article Title: Rapid and sensitive one-tube detection of mpox virus using RPA-coupled CRISPR-Cas12 assay.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains VACV Tiantan strain this paper JX489139.1 MPVX Wenjie Tan MPVX-B.1-China-C-Tan-CQ01 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin (5,000 U/mL) Thermo Fisher Scientific Cat#15070063 DMEM Hyclone Cat#SH30243.01 FBS Hyclone Cat#SH30396.02 EcoRI-HF NEB Cat#R3101S BamHI-HF NEB Cat#R3136S GenCRISPRTM Cas12a (Cpf1) Nuclease GenScript Cat#Z03502 10xNEBuffer2.1 NEB Cat# B6002S Critical commercial assays QIAamp DNA Mini Kit Qiagen Cat#51306 TwistAmp Basic kit TwistDx Cat#TABAS03KIT QuantStudio 3DDigital PCR 20KChip Kit v2 Applied Biosystems Cat#A26316 Experimental models: Cell lines Vero ATCC Cat# CRL-1586 Oligonucleotides ddPCR E9L-F this paper 50-GAACATTTTTGGCAGAGAGAGCC-30 ddPCR E9L-R this paper 50-CAACTCTTAGCCGAAGCGTATGAG-30 ddPCR Probe this paper FAM- ACGCTTCGGCTAAGAGTTGCACATCCATAMRA crRNAs and RPA primers used in the study this paper Table S1 Recombinant DNA puc57-D6R this paper N/A puc57-E9L this paper N/A puc57-N3R this paper N/A puc57-N4R this paper N/A Software and algorithms BIO-RAD CFX manager Bio-RAD 1845000 GraphPad Prism 8.0 software GraphPad Prism N/A ..

    Article Title: Cell-surface biotinylation of GABA A receptors in mouse hippocampal slices after sevoflurane anesthesia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GABRA5 monoclonal antibody Thermo Fisher Scientific MA5-27700 Na/K-ATPase Antibody Cell Signaling Technology 3010 THE beta Actin Antibody [HRP] GenScript A00702 Chemicals, peptides, and recombinant proteins Oxygen (O2) Messer 100354 Medical air Messer 100034 Carbogen gas Messer 100904 Sodium chloride (NaCl) BioShop SOD002 N-2-Hydroxyethylpiperazine-N02-ethanesulfonic acid (HEPES) BioShop HEP001 Ethylenediaminetetraacetic acid (EDTA) BioShop EDT001 Triton X-100 Sigma-Aldrich X-100 10% Sodium dodecyl sulfate (SDS) Promega V6551 cOmplete , Mini, EDTA-free Protease Inhibitor Cocktail Sigma-Aldrich 11836170001 Pierce Phosphatase Inhibitor Mini Tablets Thermo Fisher Scientific A32957 Sodium chloride (NaCl) BioShop SOD002 Potassium chloride (KCl) BioShop POC308 Magnesium chloride (MgCl2) BioShop MAG510 Calcium chloride (CaCl2) BioShop CCL302 Monosodium phosphate (NaH2PO4) Sigma-Aldrich S9638 Sodium bicarbonate (NaHCO3) Sigma-Aldrich S6014 D-glucose BioShop GLU501 EZ-LinkTM Sulfo-NHS-SS-biotin Thermo Fisher Scientific 21331 Bovine serum albumin Sigma-Aldrich A7030 Glycine Bio Basic Canada Inc. GB0235 23 Laemmli sample buffer Bio-Rad 1610737 NeutraAvidin beads Thermo Fisher Scientific 29202 Hydrochloric acid (HCl) BioShop HCL333.500 Experimental models: Organisms/strains Mouse C57BL/6, 8–9 weeks, male Charles River N/A Software and algorithms Image Lab 6.0 Bio Rad www.bio-rad.com/en-ca/sku/ 1709690-image-lab-software Prism 9 GraphPad www.graphpad.com/features Other 1.5 mL Eppendorf tubes Axygen MCT-150-C F/Air Canister Benson Medical 20522 F/Air Canister Bracket Benson Medical 20526 Scavenging tubing 19 mm magenta Benson Medical 10024 ‘‘Y’’ Piece Adapter (7 mm Ends) Benson Medical 30614-55 Silicone tubing Benson Medical 20810 Gas analyzer Datex Engstrom ULT-Svi-29-08 Heating pad Sunbeam 731-500-000R Induction chamber Benson Medical 941443 Microcentrifuge Beckman Coulter 8043-30-1145 Rotating Mixer Benchmark Scientific 1190B06 Probe sonicator Active Motif www.activemotif.com/catalog/ 719/epishear-probe-sonicatorwww. activemotif.com (Continued on next page) 4 STAR Protocols 4, 102450, September 15, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER AE150 Benchtop pH meter Fisher Scientific www.fishersci.com/shop/products/ accumet-ae150-ph-benchtopmeter/13636AE153 Sigma Delta Vaporizer Penlon www.penlon.com/Product-Groups/ Vaporizer/Sigma-Deltawww.penlon.com Leica VT1200 Microtome Leica www.leicabiosystems.com/en-ca/ research/vibratomes/leica-vt1200/ www.leicabiosystems.com ChemiDoc XRS+ Bio-Rad www.bio-rad.com/en-ca/product/ chemidoc-xrs-system ll OPEN ACCESSProtocol ..

    Article Title: Sublethal necroptosis signaling promotes inflammation and liver cancer.
    Article Snippet: I panel Bio-Rad N/A Milliplex Catalog ID.MCYTOMAG-70K-03.Mouse Cytokine MAGNETIC Kit Merck MCYTOMAG-70K-03 TUNEL Promega G3250 RNeasy Mini Kit Qiagen 74104 First-Strand Synthesis Kit Roche 04897030001 Chromium Single Cell 3‘Library & Gel Bead Kit v2 10x Genomics 120237 Chromium Single Cell A Chip Kit 10x Genomics 120236 Chromium i7 Multiplex Kit 10x Genomics 120262 RNeasy Microkit columns Qiagen 74004 Affymetrix WT PLUS reagent kit Affymetrix 902281 Affymetrix Mouse Gene 1.1 ST array plate Affymetrix 901420 Glass bottom chambers Ibidi 80427 RNAScope 2.5 HD Detection Reagents-RED assay Kit Advanced Cell Diagnostics (ACD) 322360 Mus musculus-RIPK3 probe N/A Human-RIPK3 probe N/A Chemicals, peptides, and recombinant proteins SYBR Green Reagent Invitrogen 11760-500 Rhodamine 123 Thermofisher Scientific R302 Propidium Iodide Thermofisher Scientific P1304MP Dextran, Texas red, 3000 MW Thermofisher Scientific D3328 (Continued on next page) Immunity 56, 1578–1595.e1–e8, July 11, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Labeling:

    Article Title: TERRA stability is regulated by RALY and polyadenylation in a telomere-specific manner.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-RALY Bethyl Cat#A302-069A; RRID: AB_1604210 Rabbit polyclonal anti-PABPN1 Bethyl Cat# A303-524A; RRID: AB_10949200 Rabbit polyclonal anti-EXOSC3 Proteintech Cat#15062-1-AP; RRID: AB_2278183 Mouse monoclonal anti-b-Tubulin Santa Cruz Cat# sc-5274; RRID: AB_2288090 Mouse monoclonal anti-a-Actinin Santa Cruz Cat#sc-17829; RRID: AB_626633 Rabbit polyclonal anti-mouse IgG H&L (HRP) Abcam Cat#ab6728; RRID: AB_955440 Goat polyclonal anti-rabbit IgG H&L (HRP) Abcam Cat#ab6721; RRID: AB_955447 Normal rabbit polyclonal IgG Millipore Cat# PP64; RRID: AB_97852 Sheep anti-Digoxigenin-AP, Fab fragments Roche Cat#11093274910; RRID: AB_514497 Rabbit polyclonal anti-RAP1 Novus Biologicals Cat#NB100-292; RRID: AB_10000825 Mouse monoclonal anti-phospho-Histone H2A.X Millipore Cat#05–636; RRID: AB_309864 Goat polyclonal anti-rabbit IgG-AF647 Thermo Fisher Scientific Cat#A-21245; RRID: AB_2535813 Goat polyclonal anti-rabbit IgG-AF555 Thermo Fisher Scientific Cat#A-21428; RRID: AB_2535849 Goat polyclonal anti-mouse IgG-AF488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Mouse monoclonal anti-BrdU Santa Cruz Cat#sc-32323; RRID: AB_626766 Rabbit monoclonal anti-V5 Cell Signaling Cat# 13202; RRID: AB_2687461 Chemicals, peptides, and recombinant proteins Oligofectamine Transfection Reagent Invitrogen 12252011 jetPRIME Transfection Reagent Polyplus 114–15 Actinomycin D Gibco 11805017 Pierce Protease Inhibitor Mini Tablets Thermo Scientific A32955 RiboLock RNase Inhibitor Thermo Scientific EO0381 RNaseOUT Recombinant Ribonuclease Inhibitor Invitrogen 10777019 Ribonucleoside Vanadyl Complex NEB S1402S Dynabeads Protein G Invitrogen 10003D Dynabeads M-280 Streptavidin Invitrogen 11205D SuperSignal West Pico PLUS ECL Substrate Thermo Scientific 34577 CDP-Star ECLSubstrate Roche 11685627001 TRIzol Reagent Invitrogen 15596018 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Fisher BioReagents BP1752I400 Formaldehyde Fisher BioReagents BP531-500 MOPS Fisher BioReagents BP308-100 Formamide AppliChem A2156,0500 Blocking Reagent Roche 11096176001 KAPA SYBR FAST qPCR Mastermix KAPA Biosystems KK4601 qPCRBIO SyGreen Mix Separate-ROX PCR Biosystems PB20.14–20 DNase I Thermo Scientific 89836 RNase A Macherey Nagel 740505 RNase T1 Thermo Scientific EN0541 Proteinase K Thermo Scientific EO0491 Glycogen Invitrogen 10814010 SuperScript III Reverse Transcriptase Invitrogen 18080044 dNTP Set Invitrogen 10297018 NEBuffer 3 NEB B7003S (Continued on next page) 16 Cell Reports 42, 112406, April 25, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER ProLong Diamond Antifade Mountant Invitrogen P36965 BrUTP Santa Cruz sc-495784 Critical commercial assays DIG Oligonucleotide 3-End Labeling Kit Roche 3353575910 Poly(A) RNA Selection Kit Lexogen 157.96 Experimental models: Cell lines Human: HeLa ATCC CCL-2TM Human: HeLa RALY KO Macchi Lab Rossi et al. 201739 Human: U2OS ATCC HTB-96TM Human: MCF7 ATCC HTB-22TM Human: HCT116 ATCC CCL-247TM Oligonucleotides siRNA, see Table S2 N/A N/A RT primers, see Table S2 N/A N/A qPCR primers, see Table S2 N/A N/A Blot probes, see Table S2 N/A N/A smiFISH probes, see Table S2 N/A N/A RNA pull-down oligonucleotides, see Table S2 N/A N/A Recombinant DNA pCMV6-entry Macchi Lab Origene #PS100001 pCMV6-entry-RALY Macchi Lab Gasperini et al. 201842 ppyCAG_RNaseH1_WT Zippo Lab Addgene #111906 ppyCAG_RNaseH1_D210N Zippo Lab Addgene #111904 ppyCAG_RNaseH1_WKKD Zippo Lab Addgene #111905 Software and algorithms Image Lab 6.0.1 Bio-Rad https://www.bio-rad.com/it-it/product/ image-lab-software?ID=KRE6P5E8Z ImageJ NIH https://imagej.net/ Prism 8.0.0 GraphPad www.graphpad.com BioRender BioRender BioRender.com ..

    Selection:

    Article Title: TERRA stability is regulated by RALY and polyadenylation in a telomere-specific manner.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-RALY Bethyl Cat#A302-069A; RRID: AB_1604210 Rabbit polyclonal anti-PABPN1 Bethyl Cat# A303-524A; RRID: AB_10949200 Rabbit polyclonal anti-EXOSC3 Proteintech Cat#15062-1-AP; RRID: AB_2278183 Mouse monoclonal anti-b-Tubulin Santa Cruz Cat# sc-5274; RRID: AB_2288090 Mouse monoclonal anti-a-Actinin Santa Cruz Cat#sc-17829; RRID: AB_626633 Rabbit polyclonal anti-mouse IgG H&L (HRP) Abcam Cat#ab6728; RRID: AB_955440 Goat polyclonal anti-rabbit IgG H&L (HRP) Abcam Cat#ab6721; RRID: AB_955447 Normal rabbit polyclonal IgG Millipore Cat# PP64; RRID: AB_97852 Sheep anti-Digoxigenin-AP, Fab fragments Roche Cat#11093274910; RRID: AB_514497 Rabbit polyclonal anti-RAP1 Novus Biologicals Cat#NB100-292; RRID: AB_10000825 Mouse monoclonal anti-phospho-Histone H2A.X Millipore Cat#05–636; RRID: AB_309864 Goat polyclonal anti-rabbit IgG-AF647 Thermo Fisher Scientific Cat#A-21245; RRID: AB_2535813 Goat polyclonal anti-rabbit IgG-AF555 Thermo Fisher Scientific Cat#A-21428; RRID: AB_2535849 Goat polyclonal anti-mouse IgG-AF488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Mouse monoclonal anti-BrdU Santa Cruz Cat#sc-32323; RRID: AB_626766 Rabbit monoclonal anti-V5 Cell Signaling Cat# 13202; RRID: AB_2687461 Chemicals, peptides, and recombinant proteins Oligofectamine Transfection Reagent Invitrogen 12252011 jetPRIME Transfection Reagent Polyplus 114–15 Actinomycin D Gibco 11805017 Pierce Protease Inhibitor Mini Tablets Thermo Scientific A32955 RiboLock RNase Inhibitor Thermo Scientific EO0381 RNaseOUT Recombinant Ribonuclease Inhibitor Invitrogen 10777019 Ribonucleoside Vanadyl Complex NEB S1402S Dynabeads Protein G Invitrogen 10003D Dynabeads M-280 Streptavidin Invitrogen 11205D SuperSignal West Pico PLUS ECL Substrate Thermo Scientific 34577 CDP-Star ECLSubstrate Roche 11685627001 TRIzol Reagent Invitrogen 15596018 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Fisher BioReagents BP1752I400 Formaldehyde Fisher BioReagents BP531-500 MOPS Fisher BioReagents BP308-100 Formamide AppliChem A2156,0500 Blocking Reagent Roche 11096176001 KAPA SYBR FAST qPCR Mastermix KAPA Biosystems KK4601 qPCRBIO SyGreen Mix Separate-ROX PCR Biosystems PB20.14–20 DNase I Thermo Scientific 89836 RNase A Macherey Nagel 740505 RNase T1 Thermo Scientific EN0541 Proteinase K Thermo Scientific EO0491 Glycogen Invitrogen 10814010 SuperScript III Reverse Transcriptase Invitrogen 18080044 dNTP Set Invitrogen 10297018 NEBuffer 3 NEB B7003S (Continued on next page) 16 Cell Reports 42, 112406, April 25, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER ProLong Diamond Antifade Mountant Invitrogen P36965 BrUTP Santa Cruz sc-495784 Critical commercial assays DIG Oligonucleotide 3-End Labeling Kit Roche 3353575910 Poly(A) RNA Selection Kit Lexogen 157.96 Experimental models: Cell lines Human: HeLa ATCC CCL-2TM Human: HeLa RALY KO Macchi Lab Rossi et al. 201739 Human: U2OS ATCC HTB-96TM Human: MCF7 ATCC HTB-22TM Human: HCT116 ATCC CCL-247TM Oligonucleotides siRNA, see Table S2 N/A N/A RT primers, see Table S2 N/A N/A qPCR primers, see Table S2 N/A N/A Blot probes, see Table S2 N/A N/A smiFISH probes, see Table S2 N/A N/A RNA pull-down oligonucleotides, see Table S2 N/A N/A Recombinant DNA pCMV6-entry Macchi Lab Origene #PS100001 pCMV6-entry-RALY Macchi Lab Gasperini et al. 201842 ppyCAG_RNaseH1_WT Zippo Lab Addgene #111906 ppyCAG_RNaseH1_D210N Zippo Lab Addgene #111904 ppyCAG_RNaseH1_WKKD Zippo Lab Addgene #111905 Software and algorithms Image Lab 6.0.1 Bio-Rad https://www.bio-rad.com/it-it/product/ image-lab-software?ID=KRE6P5E8Z ImageJ NIH https://imagej.net/ Prism 8.0.0 GraphPad www.graphpad.com BioRender BioRender BioRender.com ..

    Real-time Polymerase Chain Reaction:

    Article Title: TERRA stability is regulated by RALY and polyadenylation in a telomere-specific manner.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Rabbit polyclonal anti-RALY Bethyl Cat#A302-069A; RRID: AB_1604210 Rabbit polyclonal anti-PABPN1 Bethyl Cat# A303-524A; RRID: AB_10949200 Rabbit polyclonal anti-EXOSC3 Proteintech Cat#15062-1-AP; RRID: AB_2278183 Mouse monoclonal anti-b-Tubulin Santa Cruz Cat# sc-5274; RRID: AB_2288090 Mouse monoclonal anti-a-Actinin Santa Cruz Cat#sc-17829; RRID: AB_626633 Rabbit polyclonal anti-mouse IgG H&L (HRP) Abcam Cat#ab6728; RRID: AB_955440 Goat polyclonal anti-rabbit IgG H&L (HRP) Abcam Cat#ab6721; RRID: AB_955447 Normal rabbit polyclonal IgG Millipore Cat# PP64; RRID: AB_97852 Sheep anti-Digoxigenin-AP, Fab fragments Roche Cat#11093274910; RRID: AB_514497 Rabbit polyclonal anti-RAP1 Novus Biologicals Cat#NB100-292; RRID: AB_10000825 Mouse monoclonal anti-phospho-Histone H2A.X Millipore Cat#05–636; RRID: AB_309864 Goat polyclonal anti-rabbit IgG-AF647 Thermo Fisher Scientific Cat#A-21245; RRID: AB_2535813 Goat polyclonal anti-rabbit IgG-AF555 Thermo Fisher Scientific Cat#A-21428; RRID: AB_2535849 Goat polyclonal anti-mouse IgG-AF488 Thermo Fisher Scientific Cat#A-11001; RRID: AB_2534069 Mouse monoclonal anti-BrdU Santa Cruz Cat#sc-32323; RRID: AB_626766 Rabbit monoclonal anti-V5 Cell Signaling Cat# 13202; RRID: AB_2687461 Chemicals, peptides, and recombinant proteins Oligofectamine Transfection Reagent Invitrogen 12252011 jetPRIME Transfection Reagent Polyplus 114–15 Actinomycin D Gibco 11805017 Pierce Protease Inhibitor Mini Tablets Thermo Scientific A32955 RiboLock RNase Inhibitor Thermo Scientific EO0381 RNaseOUT Recombinant Ribonuclease Inhibitor Invitrogen 10777019 Ribonucleoside Vanadyl Complex NEB S1402S Dynabeads Protein G Invitrogen 10003D Dynabeads M-280 Streptavidin Invitrogen 11205D SuperSignal West Pico PLUS ECL Substrate Thermo Scientific 34577 CDP-Star ECLSubstrate Roche 11685627001 TRIzol Reagent Invitrogen 15596018 Phenol/Chloroform/Isoamyl alcohol (25:24:1) Fisher BioReagents BP1752I400 Formaldehyde Fisher BioReagents BP531-500 MOPS Fisher BioReagents BP308-100 Formamide AppliChem A2156,0500 Blocking Reagent Roche 11096176001 KAPA SYBR FAST qPCR Mastermix KAPA Biosystems KK4601 qPCRBIO SyGreen Mix Separate-ROX PCR Biosystems PB20.14–20 DNase I Thermo Scientific 89836 RNase A Macherey Nagel 740505 RNase T1 Thermo Scientific EN0541 Proteinase K Thermo Scientific EO0491 Glycogen Invitrogen 10814010 SuperScript III Reverse Transcriptase Invitrogen 18080044 dNTP Set Invitrogen 10297018 NEBuffer 3 NEB B7003S (Continued on next page) 16 Cell Reports 42, 112406, April 25, 2023 .. REAGENT or RESOURCE SOURCE IDENTIFIER ProLong Diamond Antifade Mountant Invitrogen P36965 BrUTP Santa Cruz sc-495784 Critical commercial assays DIG Oligonucleotide 3-End Labeling Kit Roche 3353575910 Poly(A) RNA Selection Kit Lexogen 157.96 Experimental models: Cell lines Human: HeLa ATCC CCL-2TM Human: HeLa RALY KO Macchi Lab Rossi et al. 201739 Human: U2OS ATCC HTB-96TM Human: MCF7 ATCC HTB-22TM Human: HCT116 ATCC CCL-247TM Oligonucleotides siRNA, see Table S2 N/A N/A RT primers, see Table S2 N/A N/A qPCR primers, see Table S2 N/A N/A Blot probes, see Table S2 N/A N/A smiFISH probes, see Table S2 N/A N/A RNA pull-down oligonucleotides, see Table S2 N/A N/A Recombinant DNA pCMV6-entry Macchi Lab Origene #PS100001 pCMV6-entry-RALY Macchi Lab Gasperini et al. 201842 ppyCAG_RNaseH1_WT Zippo Lab Addgene #111906 ppyCAG_RNaseH1_D210N Zippo Lab Addgene #111904 ppyCAG_RNaseH1_WKKD Zippo Lab Addgene #111905 Software and algorithms Image Lab 6.0.1 Bio-Rad https://www.bio-rad.com/it-it/product/ image-lab-software?ID=KRE6P5E8Z ImageJ NIH https://imagej.net/ Prism 8.0.0 GraphPad www.graphpad.com BioRender BioRender BioRender.com ..

    Membrane:

    Article Title: Tubuloid differentiation to model the human distal nephron and collecting duct in health and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NKCC2 MRC PPU N/A Anti-AQP3 Abcam ab125219 Anti-AQP2 Sigma Aldrich HPA046834 Anti-NCC Sigma Aldrich ab3553 Anti-ROMK Sigma Aldrich HPA026962 Anti-ENaC Sigma Aldrich HPA012743 Anti-Na/K-ATPase Abcam ab7671 Anti-Vimentin Dako M7020 Anti-Ki67 Abcam ab16667 Anti-acetylated-a-tubulin Santa Cruz sc-23950 AF-568 donkey anti-sheep Invitrogen A21099 AF568 donkey anti-rabbit Life technologies A10042 AF-488 donkey anti-rabbit Life technologies A21206 AF-647 donkey anti-mouse Invitrogen A31571 AF-488 donkey anti-mouse Life technologies A21202 Phalloidin–Atto 647N Sigma Aldrich 65906 Rabbit-anti-sheep DAKO P0163 Envision + System-HRP polymer anti-mouse DAKO K4001 Envision + System-HRP polymer anti-rabbit DAKO K4002 Biological samples Human kidney tissue for organoids and stainings Meander Medical Center Amersfoort N/A Chemicals, peptides, and recombinant proteins Advanced DMEM-F12 Thermo Fisher Scientific 12634–010 Penicillin/Streptomycin Thermo Fisher Scientific 15140122 HEPES Thermo Fisher Scientific 15630056 GlutaMax Thermo Fisher Scientific 35050038 R-spondin 3-conditioned medium U-Protein Express Custom order B-27 supplement Thermo Fisher Scientific 17504044 Human EGF Peprotech AF-100-15 FGF10 Peprotech 100–26 A83-01 Tocris 2939 N-Acetyl-L-Cysteine Sigma Aldrich A9165 Y-27632 dihydrochloride AbMole M1817 Primocin Invivogen ant-pm-1 Forskolin Tocris 1099 Fludrocortisone acetate Sigma Aldrich F0180000 Furosemide Sigma Aldrich F4381 Sodium acetate Riedel-de Haën 32319 Lithium acetate dihydrate Sigma Aldrich L6883 CHIR-99021 Tocris 4423 Afatinib Selleckchem S1011 SCH772984 Selleckchem S7101 (Continued on next page) 20 Cell Reports 43, 113614, January 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD0325901 Selleckchem S1036 Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 R&D Systems, Bio-Techne 3533-001-02 Dispase II Thermo Fisher Scientific 17105041 Accutase Thermo Fisher Scientific 00-4555-56 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190094 Methanol Boom 76025369.2500 Random primers Promega C1181 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Promega M3682 iQ SYBR Green Supermix Bio-Rad 1708880 Cell Recovery Solution Corning 354253 Formaldehyde 4% Sigma Aldrich 1.00496 Triton X-100 Sigma Aldrich X100 Tween 20 Sigma Aldrich P1379 Bovine Serum Albumine Sigma Aldrich A2153 DAPI Thermo Fisher Scientific D1306 VECTASHIELD antifade mounting medium Vector Laboratories H-1000-10 CellTiter-Glo 3D Cell Viability Assay Promega G9681 96-wells flat bottom chimney plate black Greiner Bio-One 655076 Sensoplate microplate 96-well glass bottom Greiner Bio-One 655892 Greiner CELLSTAR 24-well culture plates Greiner Bio-One 662160 Greiner CELLSTAR 6-well cell-repellent culture plates Greiner Bio-One 657970 Sodium chloride (NaCl) BOOM B.V. 76021267.5000 Potassium chloride (KCl) Sigma Aldrich 1049361000 Calcium chloride dihydrate (CaCl2) Sigma Aldrich 76021267.5000 Magnesium chloride hexahydrate (MgCl2) VWR 1.05833.0250 D-Gluconic acid sodium salt (Na+ D-gluconate) Sigma Aldrich G9005-500G Potassium D-gluconate (K+ D-gluconate) Sigma Aldrich 8206010500 Tris ultra pure MP Biomedicals 819619 Hydrochlorothiazide Sigma Aldrich H4759-5G Bumetanide Sigma Aldrich B3023-1G Amiloride Sigma Aldrich A7410-1g Ouabain MP Biomedicals 102541 DMSO Sigma Aldrich D5879-1L Tracer22Na+ radionuclide Perkin Elmer NEZ081500UC Crystal Violet Santa Cruz sc-207460 Critical commercial assays RNeasy mini kit Qiagen 74104 InvitrogenTM FluxORTM II Green Potassium Ion Channel Assay Fisher Scientific 15647958 Deposited data Raw and analyzed single cell-RNA sequencing data Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/ GSE206538 Software and algorithms CFX maestro software Bio-Rad N/A GraphPad Prism 8 GraphPad N/A Las X Leica N/A (Continued on next page) Cell Reports 43, 113614, January 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fiji NIH, Fiji developers https://ImageJ.net/Fiji Adobe Illustrator Adobe inc. N/A RStudio RStudio (https://rstudio.com/) N/A Seurat (version 4.1.0) Hao et al.

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Reverse Transcription:

    Article Title: Tubuloid differentiation to model the human distal nephron and collecting duct in health and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NKCC2 MRC PPU N/A Anti-AQP3 Abcam ab125219 Anti-AQP2 Sigma Aldrich HPA046834 Anti-NCC Sigma Aldrich ab3553 Anti-ROMK Sigma Aldrich HPA026962 Anti-ENaC Sigma Aldrich HPA012743 Anti-Na/K-ATPase Abcam ab7671 Anti-Vimentin Dako M7020 Anti-Ki67 Abcam ab16667 Anti-acetylated-a-tubulin Santa Cruz sc-23950 AF-568 donkey anti-sheep Invitrogen A21099 AF568 donkey anti-rabbit Life technologies A10042 AF-488 donkey anti-rabbit Life technologies A21206 AF-647 donkey anti-mouse Invitrogen A31571 AF-488 donkey anti-mouse Life technologies A21202 Phalloidin–Atto 647N Sigma Aldrich 65906 Rabbit-anti-sheep DAKO P0163 Envision + System-HRP polymer anti-mouse DAKO K4001 Envision + System-HRP polymer anti-rabbit DAKO K4002 Biological samples Human kidney tissue for organoids and stainings Meander Medical Center Amersfoort N/A Chemicals, peptides, and recombinant proteins Advanced DMEM-F12 Thermo Fisher Scientific 12634–010 Penicillin/Streptomycin Thermo Fisher Scientific 15140122 HEPES Thermo Fisher Scientific 15630056 GlutaMax Thermo Fisher Scientific 35050038 R-spondin 3-conditioned medium U-Protein Express Custom order B-27 supplement Thermo Fisher Scientific 17504044 Human EGF Peprotech AF-100-15 FGF10 Peprotech 100–26 A83-01 Tocris 2939 N-Acetyl-L-Cysteine Sigma Aldrich A9165 Y-27632 dihydrochloride AbMole M1817 Primocin Invivogen ant-pm-1 Forskolin Tocris 1099 Fludrocortisone acetate Sigma Aldrich F0180000 Furosemide Sigma Aldrich F4381 Sodium acetate Riedel-de Haën 32319 Lithium acetate dihydrate Sigma Aldrich L6883 CHIR-99021 Tocris 4423 Afatinib Selleckchem S1011 SCH772984 Selleckchem S7101 (Continued on next page) 20 Cell Reports 43, 113614, January 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD0325901 Selleckchem S1036 Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 R&D Systems, Bio-Techne 3533-001-02 Dispase II Thermo Fisher Scientific 17105041 Accutase Thermo Fisher Scientific 00-4555-56 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190094 Methanol Boom 76025369.2500 Random primers Promega C1181 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Promega M3682 iQ SYBR Green Supermix Bio-Rad 1708880 Cell Recovery Solution Corning 354253 Formaldehyde 4% Sigma Aldrich 1.00496 Triton X-100 Sigma Aldrich X100 Tween 20 Sigma Aldrich P1379 Bovine Serum Albumine Sigma Aldrich A2153 DAPI Thermo Fisher Scientific D1306 VECTASHIELD antifade mounting medium Vector Laboratories H-1000-10 CellTiter-Glo 3D Cell Viability Assay Promega G9681 96-wells flat bottom chimney plate black Greiner Bio-One 655076 Sensoplate microplate 96-well glass bottom Greiner Bio-One 655892 Greiner CELLSTAR 24-well culture plates Greiner Bio-One 662160 Greiner CELLSTAR 6-well cell-repellent culture plates Greiner Bio-One 657970 Sodium chloride (NaCl) BOOM B.V. 76021267.5000 Potassium chloride (KCl) Sigma Aldrich 1049361000 Calcium chloride dihydrate (CaCl2) Sigma Aldrich 76021267.5000 Magnesium chloride hexahydrate (MgCl2) VWR 1.05833.0250 D-Gluconic acid sodium salt (Na+ D-gluconate) Sigma Aldrich G9005-500G Potassium D-gluconate (K+ D-gluconate) Sigma Aldrich 8206010500 Tris ultra pure MP Biomedicals 819619 Hydrochlorothiazide Sigma Aldrich H4759-5G Bumetanide Sigma Aldrich B3023-1G Amiloride Sigma Aldrich A7410-1g Ouabain MP Biomedicals 102541 DMSO Sigma Aldrich D5879-1L Tracer22Na+ radionuclide Perkin Elmer NEZ081500UC Crystal Violet Santa Cruz sc-207460 Critical commercial assays RNeasy mini kit Qiagen 74104 InvitrogenTM FluxORTM II Green Potassium Ion Channel Assay Fisher Scientific 15647958 Deposited data Raw and analyzed single cell-RNA sequencing data Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/ GSE206538 Software and algorithms CFX maestro software Bio-Rad N/A GraphPad Prism 8 GraphPad N/A Las X Leica N/A (Continued on next page) Cell Reports 43, 113614, January 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fiji NIH, Fiji developers https://ImageJ.net/Fiji Adobe Illustrator Adobe inc. N/A RStudio RStudio (https://rstudio.com/) N/A Seurat (version 4.1.0) Hao et al.

    Mutagenesis:

    Article Title: Tubuloid differentiation to model the human distal nephron and collecting duct in health and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NKCC2 MRC PPU N/A Anti-AQP3 Abcam ab125219 Anti-AQP2 Sigma Aldrich HPA046834 Anti-NCC Sigma Aldrich ab3553 Anti-ROMK Sigma Aldrich HPA026962 Anti-ENaC Sigma Aldrich HPA012743 Anti-Na/K-ATPase Abcam ab7671 Anti-Vimentin Dako M7020 Anti-Ki67 Abcam ab16667 Anti-acetylated-a-tubulin Santa Cruz sc-23950 AF-568 donkey anti-sheep Invitrogen A21099 AF568 donkey anti-rabbit Life technologies A10042 AF-488 donkey anti-rabbit Life technologies A21206 AF-647 donkey anti-mouse Invitrogen A31571 AF-488 donkey anti-mouse Life technologies A21202 Phalloidin–Atto 647N Sigma Aldrich 65906 Rabbit-anti-sheep DAKO P0163 Envision + System-HRP polymer anti-mouse DAKO K4001 Envision + System-HRP polymer anti-rabbit DAKO K4002 Biological samples Human kidney tissue for organoids and stainings Meander Medical Center Amersfoort N/A Chemicals, peptides, and recombinant proteins Advanced DMEM-F12 Thermo Fisher Scientific 12634–010 Penicillin/Streptomycin Thermo Fisher Scientific 15140122 HEPES Thermo Fisher Scientific 15630056 GlutaMax Thermo Fisher Scientific 35050038 R-spondin 3-conditioned medium U-Protein Express Custom order B-27 supplement Thermo Fisher Scientific 17504044 Human EGF Peprotech AF-100-15 FGF10 Peprotech 100–26 A83-01 Tocris 2939 N-Acetyl-L-Cysteine Sigma Aldrich A9165 Y-27632 dihydrochloride AbMole M1817 Primocin Invivogen ant-pm-1 Forskolin Tocris 1099 Fludrocortisone acetate Sigma Aldrich F0180000 Furosemide Sigma Aldrich F4381 Sodium acetate Riedel-de Haën 32319 Lithium acetate dihydrate Sigma Aldrich L6883 CHIR-99021 Tocris 4423 Afatinib Selleckchem S1011 SCH772984 Selleckchem S7101 (Continued on next page) 20 Cell Reports 43, 113614, January 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD0325901 Selleckchem S1036 Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 R&D Systems, Bio-Techne 3533-001-02 Dispase II Thermo Fisher Scientific 17105041 Accutase Thermo Fisher Scientific 00-4555-56 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190094 Methanol Boom 76025369.2500 Random primers Promega C1181 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Promega M3682 iQ SYBR Green Supermix Bio-Rad 1708880 Cell Recovery Solution Corning 354253 Formaldehyde 4% Sigma Aldrich 1.00496 Triton X-100 Sigma Aldrich X100 Tween 20 Sigma Aldrich P1379 Bovine Serum Albumine Sigma Aldrich A2153 DAPI Thermo Fisher Scientific D1306 VECTASHIELD antifade mounting medium Vector Laboratories H-1000-10 CellTiter-Glo 3D Cell Viability Assay Promega G9681 96-wells flat bottom chimney plate black Greiner Bio-One 655076 Sensoplate microplate 96-well glass bottom Greiner Bio-One 655892 Greiner CELLSTAR 24-well culture plates Greiner Bio-One 662160 Greiner CELLSTAR 6-well cell-repellent culture plates Greiner Bio-One 657970 Sodium chloride (NaCl) BOOM B.V. 76021267.5000 Potassium chloride (KCl) Sigma Aldrich 1049361000 Calcium chloride dihydrate (CaCl2) Sigma Aldrich 76021267.5000 Magnesium chloride hexahydrate (MgCl2) VWR 1.05833.0250 D-Gluconic acid sodium salt (Na+ D-gluconate) Sigma Aldrich G9005-500G Potassium D-gluconate (K+ D-gluconate) Sigma Aldrich 8206010500 Tris ultra pure MP Biomedicals 819619 Hydrochlorothiazide Sigma Aldrich H4759-5G Bumetanide Sigma Aldrich B3023-1G Amiloride Sigma Aldrich A7410-1g Ouabain MP Biomedicals 102541 DMSO Sigma Aldrich D5879-1L Tracer22Na+ radionuclide Perkin Elmer NEZ081500UC Crystal Violet Santa Cruz sc-207460 Critical commercial assays RNeasy mini kit Qiagen 74104 InvitrogenTM FluxORTM II Green Potassium Ion Channel Assay Fisher Scientific 15647958 Deposited data Raw and analyzed single cell-RNA sequencing data Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/ GSE206538 Software and algorithms CFX maestro software Bio-Rad N/A GraphPad Prism 8 GraphPad N/A Las X Leica N/A (Continued on next page) Cell Reports 43, 113614, January 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fiji NIH, Fiji developers https://ImageJ.net/Fiji Adobe Illustrator Adobe inc. N/A RStudio RStudio (https://rstudio.com/) N/A Seurat (version 4.1.0) Hao et al.

    SYBR Green Assay:

    Article Title: Tubuloid differentiation to model the human distal nephron and collecting duct in health and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NKCC2 MRC PPU N/A Anti-AQP3 Abcam ab125219 Anti-AQP2 Sigma Aldrich HPA046834 Anti-NCC Sigma Aldrich ab3553 Anti-ROMK Sigma Aldrich HPA026962 Anti-ENaC Sigma Aldrich HPA012743 Anti-Na/K-ATPase Abcam ab7671 Anti-Vimentin Dako M7020 Anti-Ki67 Abcam ab16667 Anti-acetylated-a-tubulin Santa Cruz sc-23950 AF-568 donkey anti-sheep Invitrogen A21099 AF568 donkey anti-rabbit Life technologies A10042 AF-488 donkey anti-rabbit Life technologies A21206 AF-647 donkey anti-mouse Invitrogen A31571 AF-488 donkey anti-mouse Life technologies A21202 Phalloidin–Atto 647N Sigma Aldrich 65906 Rabbit-anti-sheep DAKO P0163 Envision + System-HRP polymer anti-mouse DAKO K4001 Envision + System-HRP polymer anti-rabbit DAKO K4002 Biological samples Human kidney tissue for organoids and stainings Meander Medical Center Amersfoort N/A Chemicals, peptides, and recombinant proteins Advanced DMEM-F12 Thermo Fisher Scientific 12634–010 Penicillin/Streptomycin Thermo Fisher Scientific 15140122 HEPES Thermo Fisher Scientific 15630056 GlutaMax Thermo Fisher Scientific 35050038 R-spondin 3-conditioned medium U-Protein Express Custom order B-27 supplement Thermo Fisher Scientific 17504044 Human EGF Peprotech AF-100-15 FGF10 Peprotech 100–26 A83-01 Tocris 2939 N-Acetyl-L-Cysteine Sigma Aldrich A9165 Y-27632 dihydrochloride AbMole M1817 Primocin Invivogen ant-pm-1 Forskolin Tocris 1099 Fludrocortisone acetate Sigma Aldrich F0180000 Furosemide Sigma Aldrich F4381 Sodium acetate Riedel-de Haën 32319 Lithium acetate dihydrate Sigma Aldrich L6883 CHIR-99021 Tocris 4423 Afatinib Selleckchem S1011 SCH772984 Selleckchem S7101 (Continued on next page) 20 Cell Reports 43, 113614, January 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD0325901 Selleckchem S1036 Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 R&D Systems, Bio-Techne 3533-001-02 Dispase II Thermo Fisher Scientific 17105041 Accutase Thermo Fisher Scientific 00-4555-56 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190094 Methanol Boom 76025369.2500 Random primers Promega C1181 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Promega M3682 iQ SYBR Green Supermix Bio-Rad 1708880 Cell Recovery Solution Corning 354253 Formaldehyde 4% Sigma Aldrich 1.00496 Triton X-100 Sigma Aldrich X100 Tween 20 Sigma Aldrich P1379 Bovine Serum Albumine Sigma Aldrich A2153 DAPI Thermo Fisher Scientific D1306 VECTASHIELD antifade mounting medium Vector Laboratories H-1000-10 CellTiter-Glo 3D Cell Viability Assay Promega G9681 96-wells flat bottom chimney plate black Greiner Bio-One 655076 Sensoplate microplate 96-well glass bottom Greiner Bio-One 655892 Greiner CELLSTAR 24-well culture plates Greiner Bio-One 662160 Greiner CELLSTAR 6-well cell-repellent culture plates Greiner Bio-One 657970 Sodium chloride (NaCl) BOOM B.V. 76021267.5000 Potassium chloride (KCl) Sigma Aldrich 1049361000 Calcium chloride dihydrate (CaCl2) Sigma Aldrich 76021267.5000 Magnesium chloride hexahydrate (MgCl2) VWR 1.05833.0250 D-Gluconic acid sodium salt (Na+ D-gluconate) Sigma Aldrich G9005-500G Potassium D-gluconate (K+ D-gluconate) Sigma Aldrich 8206010500 Tris ultra pure MP Biomedicals 819619 Hydrochlorothiazide Sigma Aldrich H4759-5G Bumetanide Sigma Aldrich B3023-1G Amiloride Sigma Aldrich A7410-1g Ouabain MP Biomedicals 102541 DMSO Sigma Aldrich D5879-1L Tracer22Na+ radionuclide Perkin Elmer NEZ081500UC Crystal Violet Santa Cruz sc-207460 Critical commercial assays RNeasy mini kit Qiagen 74104 InvitrogenTM FluxORTM II Green Potassium Ion Channel Assay Fisher Scientific 15647958 Deposited data Raw and analyzed single cell-RNA sequencing data Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/ GSE206538 Software and algorithms CFX maestro software Bio-Rad N/A GraphPad Prism 8 GraphPad N/A Las X Leica N/A (Continued on next page) Cell Reports 43, 113614, January 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fiji NIH, Fiji developers https://ImageJ.net/Fiji Adobe Illustrator Adobe inc. N/A RStudio RStudio (https://rstudio.com/) N/A Seurat (version 4.1.0) Hao et al.

    Cell Recovery:

    Article Title: Tubuloid differentiation to model the human distal nephron and collecting duct in health and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NKCC2 MRC PPU N/A Anti-AQP3 Abcam ab125219 Anti-AQP2 Sigma Aldrich HPA046834 Anti-NCC Sigma Aldrich ab3553 Anti-ROMK Sigma Aldrich HPA026962 Anti-ENaC Sigma Aldrich HPA012743 Anti-Na/K-ATPase Abcam ab7671 Anti-Vimentin Dako M7020 Anti-Ki67 Abcam ab16667 Anti-acetylated-a-tubulin Santa Cruz sc-23950 AF-568 donkey anti-sheep Invitrogen A21099 AF568 donkey anti-rabbit Life technologies A10042 AF-488 donkey anti-rabbit Life technologies A21206 AF-647 donkey anti-mouse Invitrogen A31571 AF-488 donkey anti-mouse Life technologies A21202 Phalloidin–Atto 647N Sigma Aldrich 65906 Rabbit-anti-sheep DAKO P0163 Envision + System-HRP polymer anti-mouse DAKO K4001 Envision + System-HRP polymer anti-rabbit DAKO K4002 Biological samples Human kidney tissue for organoids and stainings Meander Medical Center Amersfoort N/A Chemicals, peptides, and recombinant proteins Advanced DMEM-F12 Thermo Fisher Scientific 12634–010 Penicillin/Streptomycin Thermo Fisher Scientific 15140122 HEPES Thermo Fisher Scientific 15630056 GlutaMax Thermo Fisher Scientific 35050038 R-spondin 3-conditioned medium U-Protein Express Custom order B-27 supplement Thermo Fisher Scientific 17504044 Human EGF Peprotech AF-100-15 FGF10 Peprotech 100–26 A83-01 Tocris 2939 N-Acetyl-L-Cysteine Sigma Aldrich A9165 Y-27632 dihydrochloride AbMole M1817 Primocin Invivogen ant-pm-1 Forskolin Tocris 1099 Fludrocortisone acetate Sigma Aldrich F0180000 Furosemide Sigma Aldrich F4381 Sodium acetate Riedel-de Haën 32319 Lithium acetate dihydrate Sigma Aldrich L6883 CHIR-99021 Tocris 4423 Afatinib Selleckchem S1011 SCH772984 Selleckchem S7101 (Continued on next page) 20 Cell Reports 43, 113614, January 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD0325901 Selleckchem S1036 Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 R&D Systems, Bio-Techne 3533-001-02 Dispase II Thermo Fisher Scientific 17105041 Accutase Thermo Fisher Scientific 00-4555-56 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190094 Methanol Boom 76025369.2500 Random primers Promega C1181 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Promega M3682 iQ SYBR Green Supermix Bio-Rad 1708880 Cell Recovery Solution Corning 354253 Formaldehyde 4% Sigma Aldrich 1.00496 Triton X-100 Sigma Aldrich X100 Tween 20 Sigma Aldrich P1379 Bovine Serum Albumine Sigma Aldrich A2153 DAPI Thermo Fisher Scientific D1306 VECTASHIELD antifade mounting medium Vector Laboratories H-1000-10 CellTiter-Glo 3D Cell Viability Assay Promega G9681 96-wells flat bottom chimney plate black Greiner Bio-One 655076 Sensoplate microplate 96-well glass bottom Greiner Bio-One 655892 Greiner CELLSTAR 24-well culture plates Greiner Bio-One 662160 Greiner CELLSTAR 6-well cell-repellent culture plates Greiner Bio-One 657970 Sodium chloride (NaCl) BOOM B.V. 76021267.5000 Potassium chloride (KCl) Sigma Aldrich 1049361000 Calcium chloride dihydrate (CaCl2) Sigma Aldrich 76021267.5000 Magnesium chloride hexahydrate (MgCl2) VWR 1.05833.0250 D-Gluconic acid sodium salt (Na+ D-gluconate) Sigma Aldrich G9005-500G Potassium D-gluconate (K+ D-gluconate) Sigma Aldrich 8206010500 Tris ultra pure MP Biomedicals 819619 Hydrochlorothiazide Sigma Aldrich H4759-5G Bumetanide Sigma Aldrich B3023-1G Amiloride Sigma Aldrich A7410-1g Ouabain MP Biomedicals 102541 DMSO Sigma Aldrich D5879-1L Tracer22Na+ radionuclide Perkin Elmer NEZ081500UC Crystal Violet Santa Cruz sc-207460 Critical commercial assays RNeasy mini kit Qiagen 74104 InvitrogenTM FluxORTM II Green Potassium Ion Channel Assay Fisher Scientific 15647958 Deposited data Raw and analyzed single cell-RNA sequencing data Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/ GSE206538 Software and algorithms CFX maestro software Bio-Rad N/A GraphPad Prism 8 GraphPad N/A Las X Leica N/A (Continued on next page) Cell Reports 43, 113614, January 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fiji NIH, Fiji developers https://ImageJ.net/Fiji Adobe Illustrator Adobe inc. N/A RStudio RStudio (https://rstudio.com/) N/A Seurat (version 4.1.0) Hao et al.

    Viability Assay:

    Article Title: Tubuloid differentiation to model the human distal nephron and collecting duct in health and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NKCC2 MRC PPU N/A Anti-AQP3 Abcam ab125219 Anti-AQP2 Sigma Aldrich HPA046834 Anti-NCC Sigma Aldrich ab3553 Anti-ROMK Sigma Aldrich HPA026962 Anti-ENaC Sigma Aldrich HPA012743 Anti-Na/K-ATPase Abcam ab7671 Anti-Vimentin Dako M7020 Anti-Ki67 Abcam ab16667 Anti-acetylated-a-tubulin Santa Cruz sc-23950 AF-568 donkey anti-sheep Invitrogen A21099 AF568 donkey anti-rabbit Life technologies A10042 AF-488 donkey anti-rabbit Life technologies A21206 AF-647 donkey anti-mouse Invitrogen A31571 AF-488 donkey anti-mouse Life technologies A21202 Phalloidin–Atto 647N Sigma Aldrich 65906 Rabbit-anti-sheep DAKO P0163 Envision + System-HRP polymer anti-mouse DAKO K4001 Envision + System-HRP polymer anti-rabbit DAKO K4002 Biological samples Human kidney tissue for organoids and stainings Meander Medical Center Amersfoort N/A Chemicals, peptides, and recombinant proteins Advanced DMEM-F12 Thermo Fisher Scientific 12634–010 Penicillin/Streptomycin Thermo Fisher Scientific 15140122 HEPES Thermo Fisher Scientific 15630056 GlutaMax Thermo Fisher Scientific 35050038 R-spondin 3-conditioned medium U-Protein Express Custom order B-27 supplement Thermo Fisher Scientific 17504044 Human EGF Peprotech AF-100-15 FGF10 Peprotech 100–26 A83-01 Tocris 2939 N-Acetyl-L-Cysteine Sigma Aldrich A9165 Y-27632 dihydrochloride AbMole M1817 Primocin Invivogen ant-pm-1 Forskolin Tocris 1099 Fludrocortisone acetate Sigma Aldrich F0180000 Furosemide Sigma Aldrich F4381 Sodium acetate Riedel-de Haën 32319 Lithium acetate dihydrate Sigma Aldrich L6883 CHIR-99021 Tocris 4423 Afatinib Selleckchem S1011 SCH772984 Selleckchem S7101 (Continued on next page) 20 Cell Reports 43, 113614, January 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD0325901 Selleckchem S1036 Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 R&D Systems, Bio-Techne 3533-001-02 Dispase II Thermo Fisher Scientific 17105041 Accutase Thermo Fisher Scientific 00-4555-56 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190094 Methanol Boom 76025369.2500 Random primers Promega C1181 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Promega M3682 iQ SYBR Green Supermix Bio-Rad 1708880 Cell Recovery Solution Corning 354253 Formaldehyde 4% Sigma Aldrich 1.00496 Triton X-100 Sigma Aldrich X100 Tween 20 Sigma Aldrich P1379 Bovine Serum Albumine Sigma Aldrich A2153 DAPI Thermo Fisher Scientific D1306 VECTASHIELD antifade mounting medium Vector Laboratories H-1000-10 CellTiter-Glo 3D Cell Viability Assay Promega G9681 96-wells flat bottom chimney plate black Greiner Bio-One 655076 Sensoplate microplate 96-well glass bottom Greiner Bio-One 655892 Greiner CELLSTAR 24-well culture plates Greiner Bio-One 662160 Greiner CELLSTAR 6-well cell-repellent culture plates Greiner Bio-One 657970 Sodium chloride (NaCl) BOOM B.V. 76021267.5000 Potassium chloride (KCl) Sigma Aldrich 1049361000 Calcium chloride dihydrate (CaCl2) Sigma Aldrich 76021267.5000 Magnesium chloride hexahydrate (MgCl2) VWR 1.05833.0250 D-Gluconic acid sodium salt (Na+ D-gluconate) Sigma Aldrich G9005-500G Potassium D-gluconate (K+ D-gluconate) Sigma Aldrich 8206010500 Tris ultra pure MP Biomedicals 819619 Hydrochlorothiazide Sigma Aldrich H4759-5G Bumetanide Sigma Aldrich B3023-1G Amiloride Sigma Aldrich A7410-1g Ouabain MP Biomedicals 102541 DMSO Sigma Aldrich D5879-1L Tracer22Na+ radionuclide Perkin Elmer NEZ081500UC Crystal Violet Santa Cruz sc-207460 Critical commercial assays RNeasy mini kit Qiagen 74104 InvitrogenTM FluxORTM II Green Potassium Ion Channel Assay Fisher Scientific 15647958 Deposited data Raw and analyzed single cell-RNA sequencing data Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/ GSE206538 Software and algorithms CFX maestro software Bio-Rad N/A GraphPad Prism 8 GraphPad N/A Las X Leica N/A (Continued on next page) Cell Reports 43, 113614, January 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fiji NIH, Fiji developers https://ImageJ.net/Fiji Adobe Illustrator Adobe inc. N/A RStudio RStudio (https://rstudio.com/) N/A Seurat (version 4.1.0) Hao et al.

    Sequencing:

    Article Title: Tubuloid differentiation to model the human distal nephron and collecting duct in health and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NKCC2 MRC PPU N/A Anti-AQP3 Abcam ab125219 Anti-AQP2 Sigma Aldrich HPA046834 Anti-NCC Sigma Aldrich ab3553 Anti-ROMK Sigma Aldrich HPA026962 Anti-ENaC Sigma Aldrich HPA012743 Anti-Na/K-ATPase Abcam ab7671 Anti-Vimentin Dako M7020 Anti-Ki67 Abcam ab16667 Anti-acetylated-a-tubulin Santa Cruz sc-23950 AF-568 donkey anti-sheep Invitrogen A21099 AF568 donkey anti-rabbit Life technologies A10042 AF-488 donkey anti-rabbit Life technologies A21206 AF-647 donkey anti-mouse Invitrogen A31571 AF-488 donkey anti-mouse Life technologies A21202 Phalloidin–Atto 647N Sigma Aldrich 65906 Rabbit-anti-sheep DAKO P0163 Envision + System-HRP polymer anti-mouse DAKO K4001 Envision + System-HRP polymer anti-rabbit DAKO K4002 Biological samples Human kidney tissue for organoids and stainings Meander Medical Center Amersfoort N/A Chemicals, peptides, and recombinant proteins Advanced DMEM-F12 Thermo Fisher Scientific 12634–010 Penicillin/Streptomycin Thermo Fisher Scientific 15140122 HEPES Thermo Fisher Scientific 15630056 GlutaMax Thermo Fisher Scientific 35050038 R-spondin 3-conditioned medium U-Protein Express Custom order B-27 supplement Thermo Fisher Scientific 17504044 Human EGF Peprotech AF-100-15 FGF10 Peprotech 100–26 A83-01 Tocris 2939 N-Acetyl-L-Cysteine Sigma Aldrich A9165 Y-27632 dihydrochloride AbMole M1817 Primocin Invivogen ant-pm-1 Forskolin Tocris 1099 Fludrocortisone acetate Sigma Aldrich F0180000 Furosemide Sigma Aldrich F4381 Sodium acetate Riedel-de Haën 32319 Lithium acetate dihydrate Sigma Aldrich L6883 CHIR-99021 Tocris 4423 Afatinib Selleckchem S1011 SCH772984 Selleckchem S7101 (Continued on next page) 20 Cell Reports 43, 113614, January 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD0325901 Selleckchem S1036 Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 R&D Systems, Bio-Techne 3533-001-02 Dispase II Thermo Fisher Scientific 17105041 Accutase Thermo Fisher Scientific 00-4555-56 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190094 Methanol Boom 76025369.2500 Random primers Promega C1181 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Promega M3682 iQ SYBR Green Supermix Bio-Rad 1708880 Cell Recovery Solution Corning 354253 Formaldehyde 4% Sigma Aldrich 1.00496 Triton X-100 Sigma Aldrich X100 Tween 20 Sigma Aldrich P1379 Bovine Serum Albumine Sigma Aldrich A2153 DAPI Thermo Fisher Scientific D1306 VECTASHIELD antifade mounting medium Vector Laboratories H-1000-10 CellTiter-Glo 3D Cell Viability Assay Promega G9681 96-wells flat bottom chimney plate black Greiner Bio-One 655076 Sensoplate microplate 96-well glass bottom Greiner Bio-One 655892 Greiner CELLSTAR 24-well culture plates Greiner Bio-One 662160 Greiner CELLSTAR 6-well cell-repellent culture plates Greiner Bio-One 657970 Sodium chloride (NaCl) BOOM B.V. 76021267.5000 Potassium chloride (KCl) Sigma Aldrich 1049361000 Calcium chloride dihydrate (CaCl2) Sigma Aldrich 76021267.5000 Magnesium chloride hexahydrate (MgCl2) VWR 1.05833.0250 D-Gluconic acid sodium salt (Na+ D-gluconate) Sigma Aldrich G9005-500G Potassium D-gluconate (K+ D-gluconate) Sigma Aldrich 8206010500 Tris ultra pure MP Biomedicals 819619 Hydrochlorothiazide Sigma Aldrich H4759-5G Bumetanide Sigma Aldrich B3023-1G Amiloride Sigma Aldrich A7410-1g Ouabain MP Biomedicals 102541 DMSO Sigma Aldrich D5879-1L Tracer22Na+ radionuclide Perkin Elmer NEZ081500UC Crystal Violet Santa Cruz sc-207460 Critical commercial assays RNeasy mini kit Qiagen 74104 InvitrogenTM FluxORTM II Green Potassium Ion Channel Assay Fisher Scientific 15647958 Deposited data Raw and analyzed single cell-RNA sequencing data Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/ GSE206538 Software and algorithms CFX maestro software Bio-Rad N/A GraphPad Prism 8 GraphPad N/A Las X Leica N/A (Continued on next page) Cell Reports 43, 113614, January 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fiji NIH, Fiji developers https://ImageJ.net/Fiji Adobe Illustrator Adobe inc. N/A RStudio RStudio (https://rstudio.com/) N/A Seurat (version 4.1.0) Hao et al.

    Gene Expression:

    Article Title: Tubuloid differentiation to model the human distal nephron and collecting duct in health and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NKCC2 MRC PPU N/A Anti-AQP3 Abcam ab125219 Anti-AQP2 Sigma Aldrich HPA046834 Anti-NCC Sigma Aldrich ab3553 Anti-ROMK Sigma Aldrich HPA026962 Anti-ENaC Sigma Aldrich HPA012743 Anti-Na/K-ATPase Abcam ab7671 Anti-Vimentin Dako M7020 Anti-Ki67 Abcam ab16667 Anti-acetylated-a-tubulin Santa Cruz sc-23950 AF-568 donkey anti-sheep Invitrogen A21099 AF568 donkey anti-rabbit Life technologies A10042 AF-488 donkey anti-rabbit Life technologies A21206 AF-647 donkey anti-mouse Invitrogen A31571 AF-488 donkey anti-mouse Life technologies A21202 Phalloidin–Atto 647N Sigma Aldrich 65906 Rabbit-anti-sheep DAKO P0163 Envision + System-HRP polymer anti-mouse DAKO K4001 Envision + System-HRP polymer anti-rabbit DAKO K4002 Biological samples Human kidney tissue for organoids and stainings Meander Medical Center Amersfoort N/A Chemicals, peptides, and recombinant proteins Advanced DMEM-F12 Thermo Fisher Scientific 12634–010 Penicillin/Streptomycin Thermo Fisher Scientific 15140122 HEPES Thermo Fisher Scientific 15630056 GlutaMax Thermo Fisher Scientific 35050038 R-spondin 3-conditioned medium U-Protein Express Custom order B-27 supplement Thermo Fisher Scientific 17504044 Human EGF Peprotech AF-100-15 FGF10 Peprotech 100–26 A83-01 Tocris 2939 N-Acetyl-L-Cysteine Sigma Aldrich A9165 Y-27632 dihydrochloride AbMole M1817 Primocin Invivogen ant-pm-1 Forskolin Tocris 1099 Fludrocortisone acetate Sigma Aldrich F0180000 Furosemide Sigma Aldrich F4381 Sodium acetate Riedel-de Haën 32319 Lithium acetate dihydrate Sigma Aldrich L6883 CHIR-99021 Tocris 4423 Afatinib Selleckchem S1011 SCH772984 Selleckchem S7101 (Continued on next page) 20 Cell Reports 43, 113614, January 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD0325901 Selleckchem S1036 Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 R&D Systems, Bio-Techne 3533-001-02 Dispase II Thermo Fisher Scientific 17105041 Accutase Thermo Fisher Scientific 00-4555-56 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190094 Methanol Boom 76025369.2500 Random primers Promega C1181 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Promega M3682 iQ SYBR Green Supermix Bio-Rad 1708880 Cell Recovery Solution Corning 354253 Formaldehyde 4% Sigma Aldrich 1.00496 Triton X-100 Sigma Aldrich X100 Tween 20 Sigma Aldrich P1379 Bovine Serum Albumine Sigma Aldrich A2153 DAPI Thermo Fisher Scientific D1306 VECTASHIELD antifade mounting medium Vector Laboratories H-1000-10 CellTiter-Glo 3D Cell Viability Assay Promega G9681 96-wells flat bottom chimney plate black Greiner Bio-One 655076 Sensoplate microplate 96-well glass bottom Greiner Bio-One 655892 Greiner CELLSTAR 24-well culture plates Greiner Bio-One 662160 Greiner CELLSTAR 6-well cell-repellent culture plates Greiner Bio-One 657970 Sodium chloride (NaCl) BOOM B.V. 76021267.5000 Potassium chloride (KCl) Sigma Aldrich 1049361000 Calcium chloride dihydrate (CaCl2) Sigma Aldrich 76021267.5000 Magnesium chloride hexahydrate (MgCl2) VWR 1.05833.0250 D-Gluconic acid sodium salt (Na+ D-gluconate) Sigma Aldrich G9005-500G Potassium D-gluconate (K+ D-gluconate) Sigma Aldrich 8206010500 Tris ultra pure MP Biomedicals 819619 Hydrochlorothiazide Sigma Aldrich H4759-5G Bumetanide Sigma Aldrich B3023-1G Amiloride Sigma Aldrich A7410-1g Ouabain MP Biomedicals 102541 DMSO Sigma Aldrich D5879-1L Tracer22Na+ radionuclide Perkin Elmer NEZ081500UC Crystal Violet Santa Cruz sc-207460 Critical commercial assays RNeasy mini kit Qiagen 74104 InvitrogenTM FluxORTM II Green Potassium Ion Channel Assay Fisher Scientific 15647958 Deposited data Raw and analyzed single cell-RNA sequencing data Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/ GSE206538 Software and algorithms CFX maestro software Bio-Rad N/A GraphPad Prism 8 GraphPad N/A Las X Leica N/A (Continued on next page) Cell Reports 43, 113614, January 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fiji NIH, Fiji developers https://ImageJ.net/Fiji Adobe Illustrator Adobe inc. N/A RStudio RStudio (https://rstudio.com/) N/A Seurat (version 4.1.0) Hao et al.

    Maestro Software:

    Article Title: Tubuloid differentiation to model the human distal nephron and collecting duct in health and disease.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-NKCC2 MRC PPU N/A Anti-AQP3 Abcam ab125219 Anti-AQP2 Sigma Aldrich HPA046834 Anti-NCC Sigma Aldrich ab3553 Anti-ROMK Sigma Aldrich HPA026962 Anti-ENaC Sigma Aldrich HPA012743 Anti-Na/K-ATPase Abcam ab7671 Anti-Vimentin Dako M7020 Anti-Ki67 Abcam ab16667 Anti-acetylated-a-tubulin Santa Cruz sc-23950 AF-568 donkey anti-sheep Invitrogen A21099 AF568 donkey anti-rabbit Life technologies A10042 AF-488 donkey anti-rabbit Life technologies A21206 AF-647 donkey anti-mouse Invitrogen A31571 AF-488 donkey anti-mouse Life technologies A21202 Phalloidin–Atto 647N Sigma Aldrich 65906 Rabbit-anti-sheep DAKO P0163 Envision + System-HRP polymer anti-mouse DAKO K4001 Envision + System-HRP polymer anti-rabbit DAKO K4002 Biological samples Human kidney tissue for organoids and stainings Meander Medical Center Amersfoort N/A Chemicals, peptides, and recombinant proteins Advanced DMEM-F12 Thermo Fisher Scientific 12634–010 Penicillin/Streptomycin Thermo Fisher Scientific 15140122 HEPES Thermo Fisher Scientific 15630056 GlutaMax Thermo Fisher Scientific 35050038 R-spondin 3-conditioned medium U-Protein Express Custom order B-27 supplement Thermo Fisher Scientific 17504044 Human EGF Peprotech AF-100-15 FGF10 Peprotech 100–26 A83-01 Tocris 2939 N-Acetyl-L-Cysteine Sigma Aldrich A9165 Y-27632 dihydrochloride AbMole M1817 Primocin Invivogen ant-pm-1 Forskolin Tocris 1099 Fludrocortisone acetate Sigma Aldrich F0180000 Furosemide Sigma Aldrich F4381 Sodium acetate Riedel-de Haën 32319 Lithium acetate dihydrate Sigma Aldrich L6883 CHIR-99021 Tocris 4423 Afatinib Selleckchem S1011 SCH772984 Selleckchem S7101 (Continued on next page) 20 Cell Reports 43, 113614, January 23, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER PD0325901 Selleckchem S1036 Cultrex Basement Membrane Extract (BME), Growth Factor Reduced, Type 2 R&D Systems, Bio-Techne 3533-001-02 Dispase II Thermo Fisher Scientific 17105041 Accutase Thermo Fisher Scientific 00-4555-56 DPBS, no calcium, no magnesium Thermo Fisher Scientific 14190094 Methanol Boom 76025369.2500 Random primers Promega C1181 M-MLV Reverse Transcriptase, RNase H Minus, Point Mutant Promega M3682 iQ SYBR Green Supermix Bio-Rad 1708880 Cell Recovery Solution Corning 354253 Formaldehyde 4% Sigma Aldrich 1.00496 Triton X-100 Sigma Aldrich X100 Tween 20 Sigma Aldrich P1379 Bovine Serum Albumine Sigma Aldrich A2153 DAPI Thermo Fisher Scientific D1306 VECTASHIELD antifade mounting medium Vector Laboratories H-1000-10 CellTiter-Glo 3D Cell Viability Assay Promega G9681 96-wells flat bottom chimney plate black Greiner Bio-One 655076 Sensoplate microplate 96-well glass bottom Greiner Bio-One 655892 Greiner CELLSTAR 24-well culture plates Greiner Bio-One 662160 Greiner CELLSTAR 6-well cell-repellent culture plates Greiner Bio-One 657970 Sodium chloride (NaCl) BOOM B.V. 76021267.5000 Potassium chloride (KCl) Sigma Aldrich 1049361000 Calcium chloride dihydrate (CaCl2) Sigma Aldrich 76021267.5000 Magnesium chloride hexahydrate (MgCl2) VWR 1.05833.0250 D-Gluconic acid sodium salt (Na+ D-gluconate) Sigma Aldrich G9005-500G Potassium D-gluconate (K+ D-gluconate) Sigma Aldrich 8206010500 Tris ultra pure MP Biomedicals 819619 Hydrochlorothiazide Sigma Aldrich H4759-5G Bumetanide Sigma Aldrich B3023-1G Amiloride Sigma Aldrich A7410-1g Ouabain MP Biomedicals 102541 DMSO Sigma Aldrich D5879-1L Tracer22Na+ radionuclide Perkin Elmer NEZ081500UC Crystal Violet Santa Cruz sc-207460 Critical commercial assays RNeasy mini kit Qiagen 74104 InvitrogenTM FluxORTM II Green Potassium Ion Channel Assay Fisher Scientific 15647958 Deposited data Raw and analyzed single cell-RNA sequencing data Gene expression omnibus https://www.ncbi.nlm.nih.gov/geo/ GSE206538 Software and algorithms CFX maestro software Bio-Rad N/A GraphPad Prism 8 GraphPad N/A Las X Leica N/A (Continued on next page) Cell Reports 43, 113614, January 23, 2024 21 .. REAGENT or RESOURCE SOURCE IDENTIFIER Fiji NIH, Fiji developers https://ImageJ.net/Fiji Adobe Illustrator Adobe inc. N/A RStudio RStudio (https://rstudio.com/) N/A Seurat (version 4.1.0) Hao et al.

    Virus:

    Article Title: Rapid and sensitive one-tube detection of mpox virus using RPA-coupled CRISPR-Cas12 assay.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains VACV Tiantan strain this paper JX489139.1 MPVX Wenjie Tan MPVX-B.1-China-C-Tan-CQ01 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin (5,000 U/mL) Thermo Fisher Scientific Cat#15070063 DMEM Hyclone Cat#SH30243.01 FBS Hyclone Cat#SH30396.02 EcoRI-HF NEB Cat#R3101S BamHI-HF NEB Cat#R3136S GenCRISPRTM Cas12a (Cpf1) Nuclease GenScript Cat#Z03502 10xNEBuffer2.1 NEB Cat# B6002S Critical commercial assays QIAamp DNA Mini Kit Qiagen Cat#51306 TwistAmp Basic kit TwistDx Cat#TABAS03KIT QuantStudio 3DDigital PCR 20KChip Kit v2 Applied Biosystems Cat#A26316 Experimental models: Cell lines Vero ATCC Cat# CRL-1586 Oligonucleotides ddPCR E9L-F this paper 50-GAACATTTTTGGCAGAGAGAGCC-30 ddPCR E9L-R this paper 50-CAACTCTTAGCCGAAGCGTATGAG-30 ddPCR Probe this paper FAM- ACGCTTCGGCTAAGAGTTGCACATCCATAMRA crRNAs and RPA primers used in the study this paper Table S1 Recombinant DNA puc57-D6R this paper N/A puc57-E9L this paper N/A puc57-N3R this paper N/A puc57-N4R this paper N/A Software and algorithms BIO-RAD CFX manager Bio-RAD 1845000 GraphPad Prism 8.0 software GraphPad Prism N/A ..

    Polymerase Chain Reaction:

    Article Title: Rapid and sensitive one-tube detection of mpox virus using RPA-coupled CRISPR-Cas12 assay.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains VACV Tiantan strain this paper JX489139.1 MPVX Wenjie Tan MPVX-B.1-China-C-Tan-CQ01 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin (5,000 U/mL) Thermo Fisher Scientific Cat#15070063 DMEM Hyclone Cat#SH30243.01 FBS Hyclone Cat#SH30396.02 EcoRI-HF NEB Cat#R3101S BamHI-HF NEB Cat#R3136S GenCRISPRTM Cas12a (Cpf1) Nuclease GenScript Cat#Z03502 10xNEBuffer2.1 NEB Cat# B6002S Critical commercial assays QIAamp DNA Mini Kit Qiagen Cat#51306 TwistAmp Basic kit TwistDx Cat#TABAS03KIT QuantStudio 3DDigital PCR 20KChip Kit v2 Applied Biosystems Cat#A26316 Experimental models: Cell lines Vero ATCC Cat# CRL-1586 Oligonucleotides ddPCR E9L-F this paper 50-GAACATTTTTGGCAGAGAGAGCC-30 ddPCR E9L-R this paper 50-CAACTCTTAGCCGAAGCGTATGAG-30 ddPCR Probe this paper FAM- ACGCTTCGGCTAAGAGTTGCACATCCATAMRA crRNAs and RPA primers used in the study this paper Table S1 Recombinant DNA puc57-D6R this paper N/A puc57-E9L this paper N/A puc57-N3R this paper N/A puc57-N4R this paper N/A Software and algorithms BIO-RAD CFX manager Bio-RAD 1845000 GraphPad Prism 8.0 software GraphPad Prism N/A ..

    Recombinase Polymerase Amplification:

    Article Title: Rapid and sensitive one-tube detection of mpox virus using RPA-coupled CRISPR-Cas12 assay.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Bacterial and virus strains VACV Tiantan strain this paper JX489139.1 MPVX Wenjie Tan MPVX-B.1-China-C-Tan-CQ01 Chemicals, peptides, and recombinant proteins Penicillin-Streptomycin (5,000 U/mL) Thermo Fisher Scientific Cat#15070063 DMEM Hyclone Cat#SH30243.01 FBS Hyclone Cat#SH30396.02 EcoRI-HF NEB Cat#R3101S BamHI-HF NEB Cat#R3136S GenCRISPRTM Cas12a (Cpf1) Nuclease GenScript Cat#Z03502 10xNEBuffer2.1 NEB Cat# B6002S Critical commercial assays QIAamp DNA Mini Kit Qiagen Cat#51306 TwistAmp Basic kit TwistDx Cat#TABAS03KIT QuantStudio 3DDigital PCR 20KChip Kit v2 Applied Biosystems Cat#A26316 Experimental models: Cell lines Vero ATCC Cat# CRL-1586 Oligonucleotides ddPCR E9L-F this paper 50-GAACATTTTTGGCAGAGAGAGCC-30 ddPCR E9L-R this paper 50-CAACTCTTAGCCGAAGCGTATGAG-30 ddPCR Probe this paper FAM- ACGCTTCGGCTAAGAGTTGCACATCCATAMRA crRNAs and RPA primers used in the study this paper Table S1 Recombinant DNA puc57-D6R this paper N/A puc57-E9L this paper N/A puc57-N3R this paper N/A puc57-N4R this paper N/A Software and algorithms BIO-RAD CFX manager Bio-RAD 1845000 GraphPad Prism 8.0 software GraphPad Prism N/A ..

    Protease Inhibitor:

    Article Title: Cell-surface biotinylation of GABA A receptors in mouse hippocampal slices after sevoflurane anesthesia.
    Article Snippet: .. REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies GABRA5 monoclonal antibody Thermo Fisher Scientific MA5-27700 Na/K-ATPase Antibody Cell Signaling Technology 3010 THE beta Actin Antibody [HRP] GenScript A00702 Chemicals, peptides, and recombinant proteins Oxygen (O2) Messer 100354 Medical air Messer 100034 Carbogen gas Messer 100904 Sodium chloride (NaCl) BioShop SOD002 N-2-Hydroxyethylpiperazine-N02-ethanesulfonic acid (HEPES) BioShop HEP001 Ethylenediaminetetraacetic acid (EDTA) BioShop EDT001 Triton X-100 Sigma-Aldrich X-100 10% Sodium dodecyl sulfate (SDS) Promega V6551 cOmplete , Mini, EDTA-free Protease Inhibitor Cocktail Sigma-Aldrich 11836170001 Pierce Phosphatase Inhibitor Mini Tablets Thermo Fisher Scientific A32957 Sodium chloride (NaCl) BioShop SOD002 Potassium chloride (KCl) BioShop POC308 Magnesium chloride (MgCl2) BioShop MAG510 Calcium chloride (CaCl2) BioShop CCL302 Monosodium phosphate (NaH2PO4) Sigma-Aldrich S9638 Sodium bicarbonate (NaHCO3) Sigma-Aldrich S6014 D-glucose BioShop GLU501 EZ-LinkTM Sulfo-NHS-SS-biotin Thermo Fisher Scientific 21331 Bovine serum albumin Sigma-Aldrich A7030 Glycine Bio Basic Canada Inc. GB0235 23 Laemmli sample buffer Bio-Rad 1610737 NeutraAvidin beads Thermo Fisher Scientific 29202 Hydrochloric acid (HCl) BioShop HCL333.500 Experimental models: Organisms/strains Mouse C57BL/6, 8–9 weeks, male Charles River N/A Software and algorithms Image Lab 6.0 Bio Rad www.bio-rad.com/en-ca/sku/ 1709690-image-lab-software Prism 9 GraphPad www.graphpad.com/features Other 1.5 mL Eppendorf tubes Axygen MCT-150-C F/Air Canister Benson Medical 20522 F/Air Canister Bracket Benson Medical 20526 Scavenging tubing 19 mm magenta Benson Medical 10024 ‘‘Y’’ Piece Adapter (7 mm Ends) Benson Medical 30614-55 Silicone tubing Benson Medical 20810 Gas analyzer Datex Engstrom ULT-Svi-29-08 Heating pad Sunbeam 731-500-000R Induction chamber Benson Medical 941443 Microcentrifuge Beckman Coulter 8043-30-1145 Rotating Mixer Benchmark Scientific 1190B06 Probe sonicator Active Motif www.activemotif.com/catalog/ 719/epishear-probe-sonicatorwww. activemotif.com (Continued on next page) 4 STAR Protocols 4, 102450, September 15, 2023 Continued REAGENT or RESOURCE SOURCE IDENTIFIER AE150 Benchtop pH meter Fisher Scientific www.fishersci.com/shop/products/ accumet-ae150-ph-benchtopmeter/13636AE153 Sigma Delta Vaporizer Penlon www.penlon.com/Product-Groups/ Vaporizer/Sigma-Deltawww.penlon.com Leica VT1200 Microtome Leica www.leicabiosystems.com/en-ca/ research/vibratomes/leica-vt1200/ www.leicabiosystems.com ChemiDoc XRS+ Bio-Rad www.bio-rad.com/en-ca/product/ chemidoc-xrs-system ll OPEN ACCESSProtocol ..

    Article Title: Sublethal necroptosis signaling promotes inflammation and liver cancer.
    Article Snippet: I panel Bio-Rad N/A Milliplex Catalog ID.MCYTOMAG-70K-03.Mouse Cytokine MAGNETIC Kit Merck MCYTOMAG-70K-03 TUNEL Promega G3250 RNeasy Mini Kit Qiagen 74104 First-Strand Synthesis Kit Roche 04897030001 Chromium Single Cell 3‘Library & Gel Bead Kit v2 10x Genomics 120237 Chromium Single Cell A Chip Kit 10x Genomics 120236 Chromium i7 Multiplex Kit 10x Genomics 120262 RNeasy Microkit columns Qiagen 74004 Affymetrix WT PLUS reagent kit Affymetrix 902281 Affymetrix Mouse Gene 1.1 ST array plate Affymetrix 901420 Glass bottom chambers Ibidi 80427 RNAScope 2.5 HD Detection Reagents-RED assay Kit Advanced Cell Diagnostics (ACD) 322360 Mus musculus-RIPK3 probe N/A Human-RIPK3 probe N/A Chemicals, peptides, and recombinant proteins SYBR Green Reagent Invitrogen 11760-500 Rhodamine 123 Thermofisher Scientific R302 Propidium Iodide Thermofisher Scientific P1304MP Dextran, Texas red, 3000 MW Thermofisher Scientific D3328 (Continued on next page) Immunity 56, 1578–1595.e1–e8, July 11, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A

    Modification:

    Article Title: Sublethal necroptosis signaling promotes inflammation and liver cancer.
    Article Snippet: I panel Bio-Rad N/A Milliplex Catalog ID.MCYTOMAG-70K-03.Mouse Cytokine MAGNETIC Kit Merck MCYTOMAG-70K-03 TUNEL Promega G3250 RNeasy Mini Kit Qiagen 74104 First-Strand Synthesis Kit Roche 04897030001 Chromium Single Cell 3‘Library & Gel Bead Kit v2 10x Genomics 120237 Chromium Single Cell A Chip Kit 10x Genomics 120236 Chromium i7 Multiplex Kit 10x Genomics 120262 RNeasy Microkit columns Qiagen 74004 Affymetrix WT PLUS reagent kit Affymetrix 902281 Affymetrix Mouse Gene 1.1 ST array plate Affymetrix 901420 Glass bottom chambers Ibidi 80427 RNAScope 2.5 HD Detection Reagents-RED assay Kit Advanced Cell Diagnostics (ACD) 322360 Mus musculus-RIPK3 probe N/A Human-RIPK3 probe N/A Chemicals, peptides, and recombinant proteins SYBR Green Reagent Invitrogen 11760-500 Rhodamine 123 Thermofisher Scientific R302 Propidium Iodide Thermofisher Scientific P1304MP Dextran, Texas red, 3000 MW Thermofisher Scientific D3328 (Continued on next page) Immunity 56, 1578–1595.e1–e8, July 11, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A

    Transfection:

    Article Title: Sublethal necroptosis signaling promotes inflammation and liver cancer.
    Article Snippet: I panel Bio-Rad N/A Milliplex Catalog ID.MCYTOMAG-70K-03.Mouse Cytokine MAGNETIC Kit Merck MCYTOMAG-70K-03 TUNEL Promega G3250 RNeasy Mini Kit Qiagen 74104 First-Strand Synthesis Kit Roche 04897030001 Chromium Single Cell 3‘Library & Gel Bead Kit v2 10x Genomics 120237 Chromium Single Cell A Chip Kit 10x Genomics 120236 Chromium i7 Multiplex Kit 10x Genomics 120262 RNeasy Microkit columns Qiagen 74004 Affymetrix WT PLUS reagent kit Affymetrix 902281 Affymetrix Mouse Gene 1.1 ST array plate Affymetrix 901420 Glass bottom chambers Ibidi 80427 RNAScope 2.5 HD Detection Reagents-RED assay Kit Advanced Cell Diagnostics (ACD) 322360 Mus musculus-RIPK3 probe N/A Human-RIPK3 probe N/A Chemicals, peptides, and recombinant proteins SYBR Green Reagent Invitrogen 11760-500 Rhodamine 123 Thermofisher Scientific R302 Propidium Iodide Thermofisher Scientific P1304MP Dextran, Texas red, 3000 MW Thermofisher Scientific D3328 (Continued on next page) Immunity 56, 1578–1595.e1–e8, July 11, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A

    Control:

    Article Title: Sublethal necroptosis signaling promotes inflammation and liver cancer.
    Article Snippet: I panel Bio-Rad N/A Milliplex Catalog ID.MCYTOMAG-70K-03.Mouse Cytokine MAGNETIC Kit Merck MCYTOMAG-70K-03 TUNEL Promega G3250 RNeasy Mini Kit Qiagen 74104 First-Strand Synthesis Kit Roche 04897030001 Chromium Single Cell 3‘Library & Gel Bead Kit v2 10x Genomics 120237 Chromium Single Cell A Chip Kit 10x Genomics 120236 Chromium i7 Multiplex Kit 10x Genomics 120262 RNeasy Microkit columns Qiagen 74004 Affymetrix WT PLUS reagent kit Affymetrix 902281 Affymetrix Mouse Gene 1.1 ST array plate Affymetrix 901420 Glass bottom chambers Ibidi 80427 RNAScope 2.5 HD Detection Reagents-RED assay Kit Advanced Cell Diagnostics (ACD) 322360 Mus musculus-RIPK3 probe N/A Human-RIPK3 probe N/A Chemicals, peptides, and recombinant proteins SYBR Green Reagent Invitrogen 11760-500 Rhodamine 123 Thermofisher Scientific R302 Propidium Iodide Thermofisher Scientific P1304MP Dextran, Texas red, 3000 MW Thermofisher Scientific D3328 (Continued on next page) Immunity 56, 1578–1595.e1–e8, July 11, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A

    Extraction:

    Article Title: Sublethal necroptosis signaling promotes inflammation and liver cancer.
    Article Snippet: I panel Bio-Rad N/A Milliplex Catalog ID.MCYTOMAG-70K-03.Mouse Cytokine MAGNETIC Kit Merck MCYTOMAG-70K-03 TUNEL Promega G3250 RNeasy Mini Kit Qiagen 74104 First-Strand Synthesis Kit Roche 04897030001 Chromium Single Cell 3‘Library & Gel Bead Kit v2 10x Genomics 120237 Chromium Single Cell A Chip Kit 10x Genomics 120236 Chromium i7 Multiplex Kit 10x Genomics 120262 RNeasy Microkit columns Qiagen 74004 Affymetrix WT PLUS reagent kit Affymetrix 902281 Affymetrix Mouse Gene 1.1 ST array plate Affymetrix 901420 Glass bottom chambers Ibidi 80427 RNAScope 2.5 HD Detection Reagents-RED assay Kit Advanced Cell Diagnostics (ACD) 322360 Mus musculus-RIPK3 probe N/A Human-RIPK3 probe N/A Chemicals, peptides, and recombinant proteins SYBR Green Reagent Invitrogen 11760-500 Rhodamine 123 Thermofisher Scientific R302 Propidium Iodide Thermofisher Scientific P1304MP Dextran, Texas red, 3000 MW Thermofisher Scientific D3328 (Continued on next page) Immunity 56, 1578–1595.e1–e8, July 11, 2023 e2 .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A .. REAGENT or RESOURCE SOURCE IDENTIFIER Hoechst 33258 Thermofisher Scientific H21491 Hoechst 33342 Thermofisher Scientific H3570 CD45 Monoclonal Antibody (30-F11), PE Thermofisher Scientific 12-0451-83 SYTOX Green Corning, USA 451041 Cholyl-lysyl-fluorescein (CLF) Thermofisher Scientific T669 Penicillin-Streptomycin PAN Biotech P06-07100 Gentamycin PAN Biotech P06-03021 Dulbecco’s modified Eagle’s Medium (DMEM) PAN Biotech P04-03550 Williams E medium PAN Biotech P04-29510 Stable glutamine PAN Biotech P04-82100 FCS PAN Biotech P30-3702 SeraPlus FBS PAN Biotech 3702-P103009 ITS Supplement Sigma Aldrich 13146 Dexamethasone Sigma Aldrich D4902 Trizol reagent Invitrogen / Life Technologies 15596026 DAPI Vectashield; Vector Laboratories H-1200 Lipopolysaccharides (LPS) Sigma L5418 X-tremeGENE transfection reagent transfection reagent Roche 6366236001 TNF Hiss 810167-B TWEAK PeproTech 310-06 zVAD-fmk Millipore 627610 Nec-1 Biovision 2263 TPCA Tocris 2559 PhosSTOP Roche 4906837001 cOmplete Protease Inhibitor Roche 04693124001 Etanercept (Enbrel) Pfizer N/A Software and Algorithms Tissue IA image analysis software Leica N/A QuPath 0.3.0 University of Edinburgh N/A GraphPad Prism 8 Software GraphPad N/A Bio-Plex Manager Instrument Control Version 6 Bio-Rad N/A DESeq2 Love et al.64 N/A RQ manager 1.2 Applied Biosystems N/A SDS 2.3 Applied Biosystems N/A Imaris 8.1 Bitplane N/A Feature Extraction Software Agilent N/A SPSS Statistics 25 IBM N/A

    Magnetic Beads:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Imaging:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Thin Layer Chromatography:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Pore Size:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Microscopy:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Inverted Microscopy:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The phosphodiesterase 2A controls lymphatic junctional maturation via cGMP-dependent notch signaling.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Experimental models: Cell lines HDLECs PromoCell Cat# C-12216 HUVECs PromoCell Cat# C-12203 mECs This manuscript N/A Experimental models: Organisms/strains Mouse: Tie2-Cre (B6.Cg-Tg(Tek-cre) 1Ywa/J) Kisanuki et al.69 RRID:IMSR_JAX:008863 Mouse: Cdh5-CreERT2 (Tg(Cdh5-cre/ ERT2)1Rha) Sörensen et al.70 RRID:IMSR_EM:14891 Mouse: Prox1-CreERT2 (Tg(Prox1-cre/ ERT2)1Tmak Bazigou et al.71 RRID:IMSR_EM:13737 Mouse: Pde2a global knockout (B6; 129P2487Pde2A < tm1Dgen>/H; EM: 02366) Assenza et al.25 RRID:IMSR_EM:02366 Mouse: Pde2a (Pde2atm1a(EUCOMM)Wtsl) This manuscript N/A Oligonucleotides AllStars Negative CTRL siRNA Qiagen Cat# 1027281 FlexiTube PDE2A siRNA Qiagen Cat# SI00040159 DLL1 (hs00194509_m1) Thermo Fischer Scientific Cat# 4331182 GAPDH (hs99999905) Thermo Fischer Scientific Cat# 4326317E Gapdh (mm99999915_g1) Thermo Fischer Scientific Cat# 4352932E GJA4 (hs00704917_s1) Thermo Fischer Scientific Cat# 4331182 Hey1 (mm00468865_m1) Thermo Fischer Scientific Cat# 4331182 miR-139-5p (MI0000693) Thermo Fischer Scientific Cat# 002289 Mki67 (mm01278617_m1) Thermo Fischer Scientific Cat# 4331182 PDE10A (hs01098928_m1) Thermo Fischer Scientific Cat# 4351372 PDE12 (hs00698272_m1) Thermo Fischer Scientific Cat# 4331182 PDE2A (hs00159935_m1) Thermo Fischer Scientific Cat# 4331182 Pde2a (mm01136644_m1) Thermo Fischer Scientific Cat# 4331182 PDE3A (hs01012698_m1) Thermo Fischer Scientific Cat# 4331182 PDE4B (hs00963643_m1) Thermo Fischer Scientific Cat# 4331182 PDE4D (hs01579625_m1) Thermo Fischer Scientific Cat# 4331182 PDE6D (hs01062025_m1) Thermo Fischer Scientific Cat# 4331182 PDE8A (hs01079617_m1) Thermo Fischer Scientific Cat# 4331182 PSEN2 (hs01577197_m1) Thermo Fischer Scientific Cat# 4331182 RNU48 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001006 snoRNA202 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001232 snoRNA234 (TaqMan MicroRNA Assay) Thermo Fischer Scientific Cat# 001234 Pde2a-5’-arm 50ACTGGTCAGTTCTGAGC CTCACCC 30 This paper N/A Pde2a-3’-arm 50 AGTCTGGACTCCCCA TCTAGCAGG 30 This paper N/A Cre transgene sense 50GAACCTGATGG ACATGTTCAGG 30 This paper N/A Cre transgene antisense 50 AGTGCGTT CGAACGCTAGAGCCTGT 30 This paper N/A Myogenin sense 50 TTACGTCCA TCGTGGACAGC 30 This paper N/A Myogenin antisense 50 TGGGCTGGGT GTTAGCCTTA 30 This paper N/A (Continued on next page) e4 Developmental Cell 59, 1–18.e1–e11, February 5, 2024 .. REAGENT or RESOURCE SOURCE IDENTIFIER Software and algorithms BioRad Image Lab Software BioRad N/A Diva 8.0.1 software BD Biosciences N/A Fiji ImageJ N/A https://imagej.net/ij/ GraphPad Prism 9 Dotmatics N/A Leica LAS-X software Leica N/A MicroManager 1.4 software Open source N/A Seurat package Satija et al.72 https://www.nature.com/articles/nbt.3192 umap package McInnes et al.73 https://joss.theoj.org/papers/10.21105/ joss.00861 Plotly software Open source https://plotly.com/r/ FastQC (v0.11.9) Open source http://www.bioinformatics.babraham.ac. uk/projects/fastqc/ Trimmomatic (v0.36) Bolger et al.74 https://academic.oup.com/bioinformatics/ article/30/15/2114/2390096?login=true STAR (v2.7.3a) Dobin et al.75 https://academic.oup.com/bioinformatics/ article/29/1/15/272537 ComBat-seq Zhang et al.76 https://academic.oup.com/nargab/article/ 2/3/lqaa078/5909519?searchresult=1 WebGestalt platform 2019 Liao et al.77 https://academic.oup.com/nar/article/47/ W1/W199/5494758?login=true Other 24-well Plate Softwell Easy Coat hydrogels (0.1, 1, 2, 4 and 25kPa) Matrigen Cat# SS24-EC 8-well Lab-Tek II chamber slides Lab-Tek Cat# 154941 Agilent Technologies 2100 bioanalyzer Agilent https://www.agilent.com/en/product/ automated-electrophoresis/bioanalyzersystems/bioanalyzer-instrument AMPure XP magnetic beads Beckman Cat# A53880 Axiocam 208 Color Zeiss N/A BD Biosciences FACSAria IIIu BD Biosciences N/A CoolLED beam-splitter DV2 Dual View Photometrics N/A CMOS camera chip OptiMOS, Qimaging N/A DEAE-Sephadex A-25 columns Cytiva Cat# 17017001 DynaMag -2 Invitrogen Cat# 12321D Gel Doc MP Imaging System BioRad N/A Hamilton TLC syringe Sigma-Aldrich Cat# HAM7635-01-1EA Immobilion -P Transfer Membrane (0.45mm pore size) Merck Cat# IPVH00010 Inject -F syringe Braun Cat# 9166017V Leica DMI 3000 B inverted fluorescent microscope Leica N/A Leica SP8 inverted microscope Leica N/A Nikon Eclipse Ts2R microscope Nikon N/A Sheep-anti-rat IgG Dynabeads Invitrogen Cat# 110-35 StepOnePlus RT PCR system Applied Biosystems N/A Tecan Spark 10M microplate reader Tecan N/A Tissue culture-treated dishes Corning Cat# 430167 Tissue culture-treated dishes (60mm) Corning Cat# 430166 Transwell filters (0.4mm pore size) Corning Cat# 3413 (Continued on next page) Developmental Cell 59, 1–18.e1–e11, February 5, 2024 e5 .. REAGENT or RESOURCE SOURCE IDENTIFIER Tri-Carb 2100TR Liquid Scintillation Counter Packard Instruments Cat# 2000CA ULTIMA GOLD scintillation liquid PerkinElmer Cat# 6013326 UltraComp eBeads Plus Compensation Beads Invitrogen Cat# 01-3333-42 Zeiss Stemi 508 Zeiss N/A



    Similar Products

    algorithms imagej software nih image n a graphpad prism 8 graphpad n a zen blu edition zeiss n a gene expression omnibus ncbi  (Genechem)
    86
    Genechem algorithms imagej software nih image n a graphpad prism 8 graphpad n a zen blu edition zeiss n a gene expression omnibus ncbi
    Algorithms Imagej Software Nih Image N A Graphpad Prism 8 Graphpad N A Zen Blu Edition Zeiss N A Gene Expression Omnibus Ncbi, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+8+graphpad+software/a+a+a+agr2c81a+expression+genechem+genechem+genechem+gv354+gv715+identifier+luciferase+luciferase+n+n+n+resource+software+source+vector+vector+vector/pm40581931-206-207-203
    Average 86 stars, based on 1 article reviews
    algorithms imagej software nih image n a graphpad prism 8 graphpad n a zen blu edition zeiss n a gene expression omnibus ncbi - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    algorithms imaris 10 1 oxford instruments n a fiji public domain n a prism 10 0 graphpad software n a flowjo 10 8 becton dickinson n a  (Oxford Instruments)
    99
    Oxford Instruments algorithms imaris 10 1 oxford instruments n a fiji public domain n a prism 10 0 graphpad software n a flowjo 10 8 becton dickinson n a
    Algorithms Imaris 10 1 Oxford Instruments N A Fiji Public Domain N A Prism 10 0 Graphpad Software N A Flowjo 10 8 Becton Dickinson N A, supplied by Oxford Instruments, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+8+graphpad+software/Imaris/pm39813120-512-178-179
    Average 99 stars, based on 1 article reviews
    algorithms imaris 10 1 oxford instruments n a fiji public domain n a prism 10 0 graphpad software n a flowjo 10 8 becton dickinson n a - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    algorithms cfx maestro software bio rad n a graphpad prism 8 graphpad n a las x leica n a  (Bio-Rad)
    98
    Bio-Rad algorithms cfx maestro software bio rad n a graphpad prism 8 graphpad n a las x leica n a
    Algorithms Cfx Maestro Software Bio Rad N A Graphpad Prism 8 Graphpad N A Las X Leica N A, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+8+graphpad+software/CFX+Maestro+Software/pm38159278-188-256-260
    Average 98 stars, based on 1 article reviews
    algorithms cfx maestro software bio rad n a graphpad prism 8 graphpad n a las x leica n a - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    nonlinear regression algorithm graphpad prism software version 8  (GraphPad Software Inc)
    90
    GraphPad Software Inc nonlinear regression algorithm graphpad prism software version 8
    Nonlinear Regression Algorithm Graphpad Prism Software Version 8, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+8+graphpad+software/graphpad+prism+software/pmc10669220-177-16-20
    Average 90 stars, based on 1 article reviews
    nonlinear regression algorithm graphpad prism software version 8 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    algorithms bio rad cfx manager bio rad 1845000 graphpad prism 8 0 software graphpad prism n a  (Bio-Rad)
    98
    Bio-Rad algorithms bio rad cfx manager bio rad 1845000 graphpad prism 8 0 software graphpad prism n a
    Algorithms Bio Rad Cfx Manager Bio Rad 1845000 Graphpad Prism 8 0 Software Graphpad Prism N A, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+8+graphpad+software/CFX+Manager+Software/pm37848032-147-133-134
    Average 98 stars, based on 1 article reviews
    algorithms bio rad cfx manager bio rad 1845000 graphpad prism 8 0 software graphpad prism n a - by Bioz Stars, 2026-10
    98/100 stars
    		  Buy from Supplier
    software and algorithms graphpad prism 8  (GraphPad Software Inc)
    90
    GraphPad Software Inc software and algorithms graphpad prism 8
    Software And Algorithms Graphpad Prism 8, supplied by GraphPad Software Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+8+graphpad+software/graphpad+prism+software/pm37027301-210-144-149
    Average 90 stars, based on 1 article reviews
    software and algorithms graphpad prism 8 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    algorithms prism 8 4 3 graphpad n a chemidoc image lab  (Bio-Rad)
    99
    Bio-Rad algorithms prism 8 4 3 graphpad n a chemidoc image lab
    Algorithms Prism 8 4 3 Graphpad N A Chemidoc Image Lab, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+8+graphpad+software/Image+Lab+Software/pm37689068-236-127-136
    Average 99 stars, based on 1 article reviews
    algorithms prism 8 4 3 graphpad n a chemidoc image lab - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    algorithms idev software thermofisher n a zen 3 4 carl zeiss n a spectronaut software biognosys inc n a prism 8 graphpad  (Bio-Rad)
    99
    Bio-Rad algorithms idev software thermofisher n a zen 3 4 carl zeiss n a spectronaut software biognosys inc n a prism 8 graphpad
    Algorithms Idev Software Thermofisher N A Zen 3 4 Carl Zeiss N A Spectronaut Software Biognosys Inc N A Prism 8 Graphpad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+8+graphpad+software/Image+Lab+Software/pm37054706-227-31-52
    Average 99 stars, based on 1 article reviews
    algorithms idev software thermofisher n a zen 3 4 carl zeiss n a spectronaut software biognosys inc n a prism 8 graphpad - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier
    algorithms graphpad prism 8 graphpad  (Bio-Rad)
    99
    Bio-Rad algorithms graphpad prism 8 graphpad
    Algorithms Graphpad Prism 8 Graphpad, supplied by Bio-Rad, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/algorithms+graphpad+prism+8+graphpad+software/Image+Lab+Software/pm36031388-373-48-66
    Average 99 stars, based on 1 article reviews
    algorithms graphpad prism 8 graphpad - by Bioz Stars, 2026-10
    99/100 stars
    		  Buy from Supplier

    Image Search Results